[Handwrittenz ISitologiia]
`
`ISSN 004 1—3 771
`
`RUSSIAN ACADEMY OF SCIENCES
`
`CYTOLOGY
`
`CYTOLOGY —-————————99%LV1—§Z— 3
`
`Bio-MedicaL
`
`Unl. ‘of‘Mlnn.
`
`Ariosa Exhibit 1034, pg. 1
`|PR2013-00277
`
`Ariosa Exhibit 1034, pg. 1
`IPR2013-00277
`
`

`

`DEPARTMENT OF BIOCHEMISTRY, BIOPHYSICS AND
`CHEMISTRY OF PHYSIOLOGICALLY ACTIVE COMPOUNDS
`
`Journal “Cytology”
`
`founded January 1959
`
`issued 12 times a year
`
`EDITORIAL BOARD:
`
`V, Ya. ALEXANDROV. V. Ya. BRODSKY. Yu. S. CHENTSOV.
`I. I. KIKNADZE, B. E. HAMLIN (Secretary). V. M. MIKHELSON (Associate Editor}.
`N. N. NIKQLSKY (Editor-in-Chief). A. L. POLENOV. G. D. TUMANISHVILI,
`Yu. M. VASILIEV. A. V ZHIRMUNSKY
`
`[Irrelevant photo caption]
`
`©St. Peterburg Publishing Company RAN “Tsitologiya [Cytology]”, 1995
`
`Ariosa Exhibit 1034, pg. 2
`|PR2013-00277
`
`Ariosa Exhibit 1034, pg. 2
`IPR2013-00277
`
`

`

`This material may be protected by Copyright law (Title 17 US. Code)
`1995 VOL 37 N0. 3 CYTOLOGY
`
`
`
`
`
`© 1995
`
`EXTRACELLULAR DNA IN THE BLOOD OF PREGNANT WOMEN
`
`V. I. Kazakov, V. M Bozhkov, V. A. Linde, M A. Repina, V. M Mikhaylov
`
`Institute of Cytology, Russian Academy ofSciences, and Medical Academy ofPostgraduate
`Physician Education, St. Peterburg
`
`The level of extracellular DNA increases in the blood of warnen during pregnancy. By means of PCR,
`the full-size Alu repeats were observed among extracellular blood DNA repeats of pregnant women.
`Fu rthermore, with Tc65 type primer the PCR method allowed to observe in the blood DNA fragments ftanked
`by inverted Mu repeats (inter Alu repeats). The presence of such 1 type of interAlu repeats was estimated in
`the blood of women being in the first trimester of pregnancy only. but was not estimated among blood DNA
`fragments of women of the last trimester of pregnancy. It is dbmmed which types of colts may serve as a
`source of extraoell ular blood DNA (either trophobtast cells. lymphocytes. or decidual cells) , the significance
`of such DNA for pregnancy being appreciated.
`
`It has been shown that extracellular DNA is contained in the blood of humans and
`
`animals (Stroun ct a1., 1977; Fedorov, Yaneva, 1982; Vladimirov et a1., 1992). An increase in the
`content of extracellular DNA in the blood of humans has been described during pathological
`processes taking place in various types of tissue of the body, especially during certain
`inflammatory processes of the gastrointestinal tract, during tumor and infectious diseases of viral
`etiology, and during disseminated lupus (Anker et a1., 1975; Leon et a1., 1977; Shapiro ct a1.,
`1983; Stroun et a1., 1987; Goto et a1., 1991).
`The molecular mass of the extracellular DNA of the blood is on average between 1-106 to
`15-106 Da (Stroun et a1., 1977; Fedorov, Yaneva, 1982). According to EM microscopy data, the
`extracellular DNA of healthy persons is double-strand and linear (Dcnnin, 1979). According to
`Vasyukhin et a1. (1991), human extracellular DNA contains unique sequences. It has also been
`shown that the extracellular DNA of the blood during disseminated lupus has sequences capable
`of forming Z-DNA (Van Holder, 1985).
`It is believed that the high-molecular component of extracellular DNA in the blood
`comes from living cells (Stroun ct a1., 1977). It has been demonstrated in vitro that certain types
`of cells, especially lymphocytes, excrete extracellular DNA into their surroundings (Rogers et
`a1., 1972; Rogers, 1976; Stroun et a1., 1977; Fedorov, Yaneva, 1982). Furthermore, the blood
`also contains low-molecular DNA, corresponding to nuclcosomes in its mobility. In the blood of
`rats, its content increases after total X-ray exposure (Belokhvostov ct a1., 1987; Vladimirov et a1.,
`1992; Tishchenko et a1., 1993). According to Tishchenko et a1. (1993), the low-molecular DNA
`in the blood of rats after total irradiation is enriched in GC sequences. It has been conjectured
`that the low-molecular DNA in the blood is a product of intensified extrachromosomal synthesis
`
`232
`
`Ariosa Exhibit 1034, pg. 3
`|PR2013—00277
`
`Ariosa Exhibit 1034, pg. 3
`IPR2013-00277
`
`

`

`of ring DNA, detected in many types of cells of humans and mammals (Vladimirova et al.,
`1992). Our attention was drawn to the proposition that the rise in the level of extracellular low-
`molecular DNA in the blood of rats after irradiation is the consequence of increased activity of
`CaflVIg-endonuclease in the cells (Tishchenko et al., 1993). This proposition is in good
`agreement with data on the intensification of the process of apoptosis in the cells of various
`tissues of the body after irradiation (Khanson, Komar, 1985).
`It is clear from the above that analysis of the extracellular DNA in the blood of humans
`and animals is of both theoretical and practical interest. It is not ruled out that the nucleotide
`composition of the extracellular DNA of blood is not so random as not to reflect the peculiarities
`of the processes of differentiation and cell death taking place in various tissues at each particular
`moment in the life of the organism. All of this dictated our choice of the blood of pregnant
`women as the object of our research. According to available data, cellular proliferation,
`differentiation, and cell death occur in the uterus during pregnancy (Fedorova, Kalashnikova,
`1986; Mikhaylov et al., 1989, 1992a, 1992b; Mikhaylov, 1993). It was anticipated that these
`processes exert an influence on the specifics of the nucleotide composition of the extracellular
`DNA in the blood of pregnant women.
`
`Material and method
`
`We studied the blood sera of men, nonpregnant women, and women in the first and third trimester of pregnancy and
`those with late toxicosis of pregnancy. The blood was taken by syringe from the cubital vein under sterile conditions, placed in a
`centrifuge test tube, and lefi at room temperature until clotted. Immediately after the formation of a thrombus, it was removed
`from the walls of the test tube and centrifuged at 400 g for 10 min. The serum was centrifuged yet again at 2000 g for 10 min at
`4° C. The serum obtained in this way was kept at -60° C. The use of serum instead of plasma for the analysis of the DNA of the
`blood can be justified if one observes the conditions for formation of a thrombus at room temperature and immediate removal of
`the serum from the thrombus (Leon etal., 1977; Shapiro et al., 1983). Such was done in the present investigation.
`After this the serum was treated twice with phenol, mixtures of phenol and chloroform (1:1), chloroform, and isoamyl
`alcohol (24:1) and precipitated with ethanol at -20° C. The DNA preparations were analyzed in 1% agarose gel, and then used as
`the matrix in a polymerase chain reaction (PCR).
`The PCR was carried out using thermophilic DNA polymerase from Thermus thermophilus. We performed 30-35
`amplification cycles. The amplified fragments were analyzed in 8% PAAG. The annealing temperature of the primers was 55" C
`for primers B1 and C2 and 60° C for primer Tc65, the concentration of Mg2+ ions being 2-5 mM. The primers for the PCR were
`synthesized by us with the solid-phase triether phosphite method in the B-cyanoethyl modification on the Gene assembler
`instrument from Pharrnacia. The sequence of the T065 primer was taken from literature sources (Nelson et al., 1989), the
`sequences of the other primers were found with the help of the Oligo program (Microsoft) for the consensus sequence of Alu
`repeats of the MF family and designated as B1 and C2 by us.
`When the PCR was carried out with the pair of primers B1 and C2, an Alu repeat with a length of 239 base pairs was
`amplified as a result of the reaction. When only one primer Tc65 was used in the PCR, DNA fragments were amplified that were
`flanked by two Alu repeats with their terminal 3’ regions facing each other (inter-Alu repeats).
`The sequences of the primers are:
`
`Tc65—5 '—AAG'I‘CGCGGCCGCTTGCAGTGAGCCGAGA—3 ’
`B l —5'—CCTGTAATCCCAG CAC'I‘TI‘GG GAGGC— 3'
`czws'mcccmocgcomrocg GTGG-B'
`Results and discussion
`
`It was not our goal to study in detail the changes in the concentrations of DNA in the
`blood serum of pregnant women. From the data of authors using radioimmunological methods of
`determination (Leon et al., 1977; Shapiro et al., 1983), the concentration of DNA in the blood
`sera of healthy donors varied from 0 to 0.1 mcg/ml; according to authors using biochemical
`methods (Anker et al., 1975; Stroun et al., 1987), from 0.1 to 0.6 meg/ml. Our data on the
`
`233
`
`Ariosa Exhibit 1034, pg. 4
`|PR2013-00277
`
`Ariosa Exhibit 1034, pg. 4
`IPR2013-00277
`
`

`

`concentration of DNA in the blood of men and nonpregnant women corresponded to the
`literature data.
`
`According to our data findings, during pregnancy there is an increase first of all in the
`concentration of low-molecular DNA, the increase being most pronounced during gestosis. The
`size of such DNA is from 150 to 2500 base pairs. There is a belief that the increase in
`concentration of low-molecular extracellular DNA in the blood is a consequence of increased
`synthesis of extrachromosomal DNA (Vladimirov et al., 1992). However, in evaluating the data
`presented, one must consider that a substantial number of endometrial cells perish during
`pregnancy, especially at the end of pregnancy and in connection with gestosis (Kottsova et al.,
`1989; Mikhaylov et al., 1992a). According to our data, the death of decidual cells is attended by
`a gradual loss of nuclear DNA and fragmentation of peripheral parts of the nuclei and cytoplasm
`and, apparently, this occurs by apoptosis (Mikhaylov et al., 1992a, 1992b; Mikhaylov, 1993).
`One of the major mechanisms of cell death of the apoptosis type is internucleosomal degradation
`of DNA due to activation of Ca2+ endonuclease (Wyllie, 1980). This does not rule out the
`possibility of extrachromosomal copying of DNA as the source of the extracellular DNA in the
`blood. Regardless of whether intensified synthesis of extrachromosomal DNA or apoptotic cell
`death is the source of the extracellular DNA in the blood, the presence of Alu repeats in it
`testifies to its nuclear origin (Fig. 1; see insert VIII).
`Worthy of attention is the presence of inter-Alu repeats among the DNA of the blood
`serum of pregnant women. It is known that approximately a third of the Alu repeats of humans
`belongs to the inverted repeats, and the mean distance between inverted pairs is approximately
`50 t.p.n. (Jelinek, Schmid, 1982). The bulk of such inverted repeats apparently contain a unique
`internal fragment. There are several kinds of inter—Alu repeats. With the help of the T065 primer,
`we detected inter-Alu repeats in the blood of women only in the first trimester of pregnancy (Fig.
`2). When the PCR was carried out with the Tc65 primer, only those DNA fragments are
`amplified in which the spacer DNA is flanked by Alu repeats mutually facing each other by their
`3’ regions, which makes these fragments even more unique. Thus, if the presence in the blood of
`pregnant women of an increased quantity of low-molecular DNA fragments is a sign of increased
`cell death occurring in the uterus in all phases of pregnancy, then the presence of inter-Alu
`repeats indicates the functioning of other mechanisms for such sequences getting into the serum.
`It is important that inter-Alu repeats have been detected only in the blood of women in the first
`trimester of pregnancy. This fact most likely reflects the difference in content of the cellular
`processes that are characteristic of the early and late stages of pregnancy. While at the end of
`pregnancy there is observed a death of decidual cells, which explains increase in concentration of
`low-molecular DNA in the blood; in the initial period of pregnancy when implantation and
`placentation of the embryo in the uterus occurs, there is decidualization of the endometrium and
`growth of the embryonal vesicle, i.e., a process of differentiation of the cells of the uterine
`mucous membrane and cells of the trophoblast.
`It is likely that, in the early stages of pregnancy, an excretion of inter-Alu repeats from
`the cells occurs. Which type of cells can excrete inter-Alu repeats is a matter of great interest.
`This question also confronts investigators when discussing the sources of high-molecular serum
`DNA (see the survey: Fedorov, Yaneva, 1982). Excretion of DNA in vitro has been well
`characterized for lymphocytes (Fedorov, Yaneva, 1982). It is assumed that the lymphocytes
`might be the source of such DNA during tumor diseases. In the early stages of pregnancy,
`substantial lymphocyte infiltration is also observed in the uterine mucous membrane.
`
`234
`
`Ariosa Exhibit 1034, pg. 5
`|PR2013-00277
`
`Ariosa Exhibit 1034, pg. 5
`IPR2013-00277
`
`

`

`Thus, in the early stages of pregnancy in humans, cells of the fetus (trophoblasts) and the
`mother (cells of the endometrium and lymphocytes) may excrete DNA. In View of the above, and
`also considering the transposonic and recombinogenic nature of the Alu repeats (Tomilin, 1992),
`it can be conjectured that the inter-Alu repeats discovered by us in the blood serum of pregnant
`women may play some kind of regulatory role in the early stages of pregnancy. The cloning and
`sequencing of these fragments is of particular interest. What has been said does not rule out the
`presence of other inter-Alu repeats in the blood of pregnant women, which can be identified by
`means of other primers and may have their own features of distribution in the blood in the course
`of pregnancy.
`
`Bibliography
`
`Belokhvostov A. S., Lebedev S. N., Sherlina S. S. “Changes in the fractional makeup of
`nucleic acids of the blood serum during radiation injuries”, Radiobiologiya, J 98 7, vol. 27, No. 4,
`pp. 505-509.
`Vasyukhin V. I., Lz'pskaya L. A., Tsvetkov A. G, Podgornaya 0. 1., “DNA coming from
`human lymphocytes contains sequences homologous to the immunoglobulin gene”, Molekulyar.
`bj0_l., 199], vol. 25, No.2, pp. 405-412.
`Vladimirov V. G, Belokhvostov A. S., Sherlina S.S., Vasilyeva I. N., Voskresenskz'y A.M,
`“Content of extracellular DNA in the blood of irradiated rats”, gig]. eksperim. biol. med., 1992,
`vol. 63, No.2, pp. 188-190.
`Kottsova N. A., Bystrova 0. A., Susloparov L. A., Mikhaylov V. M, “Changes in the
`cellular makeup of the deciduous membrane during the physiological course of pregnancy and
`one with late toxicosis”, Arkh. anat. gistol. embriol., 1989, vol. 97, No. 11, pp. 76-82.
`Mikhaylov V. M, “Ultrastructure of the nuclei during programmed cell death of the
`decidua”, Tsitologiya, 1993, vol. 35, No. 10, p. 85.
`Mikhaylov V M, Lebedeva G. S., Shteyn G. 1., “Changes in the quantity and synthesis of
`DNA in nuclei of the large decidual cells of the rat in the course of differentiation”, Tsitologiya,
`1989, vol. 31, No. 6, p. 677—684.
`Mikhaylov V. M, Linde V. A., Rozanov Yu. M, Tatarova N. A., Susloparov L. A.,
`Konycheva Ye. A., “Synthesis and content of DNA in the cells of human decidua during
`differentiation according to data of the DNA flow cytometry method”, Tsitologiya, 1992a, vol.
`34, N0. 6, p. 67-73.
`Mikhaylov V M, Rozanov Yu. M, Linde V. A., Tatarova N. A., Bystrova 0. A., “The
`terminal stage of differentiation of cells of the decidua”, Abstracts of Papers of the XI Congress
`of Anatomists, Histologists and Embryologists, Poltava, 1992b, p. 164.
`Tishchenko L. N., Vladimirov V. G, Vasilyeva I. N., “The role of CaflVIg endonuclease of
`chromatin in the formation of extracellular DNA of blood”, Tsitologiya, I 993, vol. 35, No. 10, p.
`96.
`
`Fedorov N. A., Yaneva N. 5., “Expression of DNA by human lymphocytes”, Uspekhi
`sovrem. biol., 1982, vol. 93, No. 2, pp. 171-182.
`Fedorova M F., Kalashnikova Ye. P., Platsenta i yeye rol’ pri beremennosti [The
`placenta and its role in pregnancy], Meditsina: Moscow, 1986, 253 pp.
`Khanson K. P., Kamar V. Ye., Molekulyamye mekhanizmy radiatsionnoy gibeli kletok
`[Molecular mechanisms of radiation cell death], Energoatomizdat: Moscow, 1985, 150 pp.
`
`235
`
`Ariosa Exhibit 1034, pg. 6
`|PR2013-00277
`
`Ariosa Exhibit 1034, pg. 6
`IPR2013-00277
`
`

`

`limiter?” StrounM.‘. Maurine RA. Spontaneous release of DNA by human blood lymphocytes as
`shown in wtrosystem /I CancerRes. 1975. Vol.35. P. 375—2382.
`DenninR. H. DNA of free and compicxed origin in human plasma: concentration and length
`distribution // Kiiuische Wochenschrifr. 1979. Vol. 57. P. 451—456.
`.
`'
`GotoM., Kazarhinm Ii. Sht'bataM” Morishirrta T.. K!mumH., FutamumM. K3011. Ando T.
`Detection of viral DNA in neonatal herpes simplex virus infections: frequent and prolonged presence in
`serum and cerebrospinnl fluid // J. Infect. Disease. I99I. Vol. 164. P. 289*293.
`Jelinek W. 12., Schmid C. W. Repetitive sequences in enknryotic DNA and their expression //
`Ann. Rev. Biochem. 1982. Vol. 51. P. 313—814.
`Leon S. A. ShapiroB., Sklaroff D. M. Yarns M. J. Free DNA in the sera of cancer patients and the
`effect of therapy // Cancer Res. 1977. Vol. 37. P. 646m~650.
`.
`Nelson 1)., Ladbem'r S.. CorfoL Mu polymerase chain reactiort: a method for rapid isolation of
`goggfingospggisflfic sequences from complex DNA sources If Proc. Nat. Acad. Sci. USA. 1989. Vol. 86.
`Roger: J. C. Identification of an intracellular precursor of DNA cxctmcted
`human 1 m ho
`es If
`Proc. Nat. Acad. Sci. USA. I976. Vol. 73. P. 3211-43215.
`by
`y p
`631
`Rogers J. C.. Bold 0;. Kondeld 3., Skinner S. 2%.. Vaiert C. L Excretion of deoxyribonucleic acid by
`iymgtggcytesfissgmuiated with phytohemngglutlnln or antigen ll Proc. Nat. Acad. Sci. USA. 1972. Vol. 69.
`.
`P. l —l
`ShapiraB., ChakrabnrtyM.. Calm E. M. Leon S. .4. Determination of circulating DNA levels in
`patients with benlgh ormalignant gastrointestinal disease II Cancer. I983. Vol. 51. P. 2i 16--_21 20.
`Straun M., AME. Lymtteyl.. lederrey 0.. Maurice P. A. isolation and characterisation of DNA
`from. the plasma of cancer patients ll Eur. J. Cancer Clin. Onooi. 1987. Vol. 23. P. 701—“ 2.
`Straw: M., Auker P.. Maurice P.A.. Gahan P. B. Circulating nucleic acids in higher organlzms ll
`int. Rev. Cytol. 1977. Vol. 51. P. i—48.
`TomiliuN. V. Mechanisms of chromosome destabilization in human cells If Sov. Sci. Rev. D.
`Physicochem. Biol. 1992. Vol. 10. P. 39—89.
`'
`'
`VanHeIdenP. .0. Potential z-DNA forming elements in sera DNA from human systemic lupus
`erythematosns // J. Immunol. 1985. Vol. 136. P. 177—179.
`Wylit'e A. H.- Glucocortlcold-induced thymocyte apoptosls is associated with endogenous endonuclease
`activation ll Nature. 1980. Vol. 284. P. 555—556.
`
`Received 6 September 1994
`
`EXTRACELLULAR DNA OF PREGNANT WOMEN BLOOD
`
`V. I. Kazakav, V. M. Bozhkov. V. A. Unite. M. A. Reptrta. V. M. Mikhailov
`
`institute of Cyhlogy. Russian Academy oi Sciences; and Medical Audi-4w
`of Postgraduate Education, St. Potassium »
`
`The level of extracellular DNA increases in the blood of women during pregnancy. By means of PCR,
`the full- size Alu repeats were observed among extracellular blood DNA repeats of pregnant women.
`Furthermore, with Tc65 type primer the PCR method allowed to observe in the blood DNA fragmenlc fIonized
`by inverted Alu repeats (inter Alu repeats). The presence of such a type of inter Aiu repeats was estimated in
`the blood of women being in the first trimester of pregnancy only. but was not estimated among blood DNA
`fragments of women of the last trimester of pregnancy. It is discussed which types of cells may serve as a
`source of extracellular blood DNA (either trophobtnst cells. lymphocytes. or decidual cells) . the significance
`of such DNA for pregnancy being appreciated.
`
`236
`
`Ariosa Exhibit 1034, pg. 7
`|PR2013-00277
`
`Ariosa Exhibit 1034, pg. 7
`IPR2013-00277
`
`

`

`T0 the article by V. I. Kazakov, V. M Bozhkova, V. A. Linde (p. 232)
`
`INSET VIII
`
`
`
`7
`
`3
`
`11
`
`5
`
`5
`
`7
`
`3
`
`Fig. 1. DNA fragments obtained by carrying out polymerase chain reaction with a pair of primers B1 and C2.
`Synthesis of a full-length Alu-repeat.
`
`I — DNA of )t phage digested by PstI; 2 — DNA from blood serum of a male; 3 — DNA from blood serum of a non-
`pregnant female; 4 — DNA from blood serum of a pregnant woman, I trimester; 5 — DNA from blood serum of a
`pregnant woman, III trimester; 6 — DNA from blood serum during gestosis; 7 — DNA from a blood thrombus of a
`pregnant woman, III trimester; 8 — total human DNA; 9 — Pall plasmid with a cloned Alu-repeat; 10 — reaction
`without template; 1 I — reaction without primers.
`
`Fig. 2. DNA fragments obtained by carrying out polymerase chain reaction with the primer Tc65 (inter-Alu-repeat)
`
`1-8 — DNA from blood serum samples of several pregnant women, I trimester.
`
`Ariosa Exhibit 1034, pg. 8
`|PR2013-00277
`
`Ariosa Exhibit 1034, pg. 8
`IPR2013-00277
`
`

`

`L/m
`
`[~5i f0 /OjiI 0L
`
`POCCI’IMCKAS AKAHEMHH HAVK
`
`ISSN 0041—3771
`
`HI/ITOHOFI/IH
`CYTOLOGY————-
`
`Library
`
`Univ. of‘Minn.
`Bio-Medicali;
`
`Ariosa Exhibit 1034, pg. 9
`|PR2013-00277
`
`Ariosa Exhibit 1034, pg. 9
`IPR2013-00277
`
`

`

`OTZLEJIEHI/IE BI/IOXI/IMI/IH, BI/IOGDI/BI/IKI/I M XI/IMI/lI/I
`(DI/I3I/IOJIOI‘I/ItIECKI/I AKTI/IBHBIX COEHKHEI—H/II/I
`
`)KypHaJI «Ilmonorm»
`
`OCHOBaH B HHBape 1959 r.
`
`Buxoéum 12 pm 3205
`
`PERAKLII’IOH'H'ASI’KOJIJIEI‘HSI:
`
`B. H. AJ'IEKCAHIIPOB. B.$I.BPO)1CKHH, IO. M. BACPUIbEB.
`A. B. XHPMYHCKPIH, PI. PI. KMKHAIKBE.
`E. E. MAXJIVIH (owaeTCTBeHHbm cereTapb) .
`B. M. MHXEJIb COH (3aM. maaHom penauropa) ,
`H. H. HI/IKOIIbCKMH (manubn‘x penaxTop) ,
`A. II. I'IOJIEHOB, I‘. J1.TYMAHHIJ.IBI/IJ'IVI. 10. C. ‘IEHLIOB
`
`EDITORIAL BOARD:
`
`V.Y11.AI,EX.ANDROV, V. Ya. BRODSKY, Yu. S. CHENTSOV,
`I. I. KIKNADZE. E. E. MAKHLIN (Secretary) . V. M. MIKHELSON (Assdciaté Editor) ,
`N. N. NIKOLSKY (Editor-invChief), A. L. POLENOV. G. D. TUMANISHVILI,
`Yu. M. VASILIEV, A. V. ZHIRMUNSKY
`
`uccxledoeauuu c no-
`Ha nuqeeozi cmopoue o6n0>m<w myéeubxneax mxaub cmwdxu ypzuwcxod npu H. H. Fopduemco a
`M0u4bro crcanupyrougezo anexmpou Hozo Mquocxona (cm. cmamwo T, H. Hoeuxoeozi,
`3171024 Momepe).
`
`© C.—Herep6yprcxan nanaTenbcxan dmpma PAH
`«Hmonomx», 1995 r.
`
`Ariosa Exhibit 1034, pg. 10
`|PR2013-00277
`
`Ariosa Exhibit 1034, pg. 10
`IPR2013-00277
`
`

`

`This material may be protected by Copyright law (Tit|e 17 US. Code)
`1995 TOM 37,N93 I III/ITOJIOl‘I/ISI V
`
`
`
`
`
`
`
`
`
`© 1995
`
`‘BHEKJIETOFIHASI lIHK B KPOBI/I BEPEMEHHLIX )KEHHII/IH
`B. H. Kasaxoe, B. M. onxoe, B. A. JquDe, M. A. PenuMa, B. M. Muxazinoa
`
`Hucmumym qumonbzuu PAH u Mefiuquucmx axaaemun nocnefiunnomuoeo ofipaaoaanux spa-ted,
`Cauxm-Hemepfiypz
`
`Hoxaaauo yacnu “cane xouueurpaunn memo-rounofi LLHK a xposn 6epcmennmx max-mum. nan6onec
`nupaxeufloe an necroae, Irro moxer 65m: canaémo c méenbio neumyanhnux KneToK, nponcxonfimefi no
`mexanuamam anomoaa. B CblBOpOTKC xponu )KeHmm-II 14 III TpMMeCrpOB fiepeMeHHocm npu normal" 110-
`.rmmepaznofi uenHofi peaxunu oéuapyxeua )IHK. conepmaman Hedgpamemuposauuue Alu-nOBTopr.
`Kpome rom, npu nonoum npafimepa Tc65 ’I’OJleO n cunopome KpOBH )KCHILlHH I-rpnMecha éepeMeHHocm
`06Hapy>KeHu cbpamembl Ill-IX. danauxuposauuue HHBepTHpOBaHH‘bIMH Alu-non‘ropaMn (nurep-Alu—no—
`BTopaMH) . O6cyx<Aaxorcx aomomuocm axcxpeuuu mrep-AJu-nomopon Kne'rxamn nnona (KJICTKaMH
`'rpocbo6nac-ra) n narxn (xnerxamn swam-rpm H nnMcboumaMH) u perynsrropnofi dyynxmm Taxofi HHK
`Ha pammx cpoxax éepemcunocm.
`
`Hoxasano, um B Kponn uenonexa n xmaomux conepxmcg BHCKJICTO‘IHaSI
`IlHK (Stroun et al., 1977;
`(Denopon. 51mm, 1982; Bnanm/mpon u 11p., 1992).
`Ynennqenue Konuempaunu BHeKJIeTOImofi JIHK B xponn y moneiix OIIPIC8H0 npn
`na'ronomqecxnx npoueccax, nporexammnx a paanmxrmx 'I‘KaHax opraxmama, B
`uacmoc'm 11pm Hexoropux Bocnann'renbaux npoueccax xenynomo—Knmeqnoro
`Tpax'ra, npu onyxonenux n umbexuuoaaux 3a6oneaammx BKPYCHOH s'monorun,
`npn neccnmnnnponaamfinonqanxe (Ankcr et 31., 1975; Leon et al., 1977; Shapiro
`et al., 1983; Stroun et al., 1987; Goio et al., 1991).
`Mon. macca Buemeroqnofi HHK Kponn B cpenHeM cocwaanaer OT 1 - 106 no
`15 - 10‘S Ila (Stroun et 31., 1977; (Denopon, 5111633, 1982). 1'10 naHHHM BM—MHK—
`pocxomm Baeme'rouaaa IIHK xpoxm snoponux monefi'nnge'rca nayxuenoueqnofi
`n Jmnefin‘ofi (Dcnnin, 1979). Ho uaHHHM Bacmxmia n coa‘mopon (1991), anemo-
`To'maa IIHK uenonexa conepxm yumcanbnble nocnenoaa'renbnoc'm. Taxxce no—
`K333H0,
`two up}! necchHanonaHHof/I Bonqamcc BO BHemeTquofi IIHK KpOBH
`EIMCIOTCSI nocnenona'renhnocm, cnocoéxme oépaaosuna'rb Z-ILHK (Van Holder,
`1985).
`Cumae'rcn, u'ro BHCOKOMoneKymapHufi KOMIIOHCHT BHeIUIe'rquofi HHK xponn
`nponcxomn‘ n3 xnnux.,me'rox (Stroun st 211., 1977). Hoxaaano in vitro, uro
`HCKOTOpHe mum me’rox, OCO56HHO JIKMdmLLHTH, axcxpernpym B cpeny BHCOKO-
`MoneKmepHylo LLHK (Rogers et 31., 1972; Rogers, 1976; Stroun et al., 1977;
`(Dcnopon, 51216133, 1982). KpOMc Tom, B xponm conepxm'rcx 'raxxc rmaxomonexy-
`napuasx HHK, coowne'rc'rayloman no nonnnxmocm nyneocomaM. B xponn KpHC ee
`conepxanne soapac'raer nocne 0611mm pemrenoncxoro o611yuemu (Benoxnoc'ron
`a 11p., 1987; Bnanpmupon u up., 1992; Tnmcnxo n 11p., 1993). Ho naHHHM Tn—
`memco n coaB'ropos '(1993), Imaxomonexynnpnax IIHK Kponn Kpuc nocne 0611mm
`oényuemm odor‘alnena I‘U‘jnocnenoaa'renbnoc'rmu. Bucxaaaua Toqxa sperms; 0
`TOM, Irro ansxomonexynfipnaa HHK xponn ecu: nponyxr ycwleHHoro excrpaxpo—
`MOCOMHOPO CH'HT638 KOJIBIIBBHX HHK, oGnapyermix y MHomx 'mnon me'rox'
`qenonexa u Mnexonmaloumx (Bnammnpos n 11p., 1992). Hame Barman: npu-
`memo npczmonoxennc o TOM, q'ro nonumcrme ypomm Bnemeroqnofi HESKOMO-
`
`232
`
`Ariosa Exhibit 1034, pg. 11
`|PR2013-00277
`
`Ariosa Exhibit 1034, pg. 11
`IPR2013-00277
`
`

`

`nexynspnofi EHK B KpOBM KphIC nocne oSnyuenua ecu: cnencmue yCHJIeHHSI
`aKTuBHocm B 10161“an Ca/Mg—annonymeaam (Tnmcnxo M 11p., 1993).- 3T0 upen-
`nonoxerme xopomo cornacye'rca c IlaHHhIMH 06 ycrmemm nponeccon anonroaa B
`Kne'rxax pasnnqu Txanefi opramxama uocne oényuemm (Xchon, KOMap, 1985).
`1/13 cxaaaHHoro acne, um ananna Bneme'rounoi'i
`,ZIHK KpOBIl qenosexa n
`xnsommx nmee'r Kax reopermecxnfi, Tax u upax'rmecxnfi MHTegec. He ncxmo—
`11630, um Hymeomzmmfi coc'ras BHeKJIeTotmofi ILHK xponn He Hac'ronbxo cnyqa—
`CH, uroéu B HeM He mpaamma: OCOGBHHOCTPI nponeccon nmbtbcpeunuponxn PI
`me'roqnofi ru6eJm, npm-exalomefi a paaamx TKaHfix B xaxuxmfi omenbnmfi‘momem
`)KHBHPI oprannama. Bce 3T0 onpenemmo Bu6op B xauec'rse o6'bex'ra 111151 Hacz‘osunero
`nccnenonamm KpOBPI 6CpBMeHHbLX maximum. 110 nmerompmca 1131111111114, 3 ma'rKe npn
`6cpcmcnnocm HMBIO’I‘ mec'ro Kne'roqnaa nponncbepalma, nn¢daepemmponxa n m—
`6em> merox ((Denopona, KaflamHKKOBa, 1986; Mnxafinon M up., 1989, 19923,
`19926; Mnxafifloa, 1993). Oxmanocn, no 3114 nponeccu oxaxyT CBOC BJmsmne
`Ha cneundmxy Hymeomzmoro cocu-asa BHemeTOMHofi LII-1K Kponn 6epemeHHLIx
`meamnn.
`
`MaTepMan M meTouMKa
`
`I/IccnenosaJIM CblBODOTKM KpoaM mymuMH, He6epcM6HHb1x )KCHILLHH, )KeHmMH I M III TpMmecrpon 6e-
`peMeHHOCTH M c noanHMM Toxcuxoaom 6epeM6HHOCTM. Kponh 6panM manueM M3 noxreaoM BCHbl a on:-
`pMJ'lebIX ycnoaMax, nomemanM B ueHTpMcbymuyio npoGMpKy M oc-rannsum an KOMHaTHoM Tennepa'rype
`no caeprxaaHMn. Cpaay nocne ofipaaoaaHMn 'rpom6a ero omeJmnM 0T creuox npo6MpKM M ueHTqunerpo-
`mum an 400g 5 TB‘IBHHe 10 MHH. CbIBOPOTKy ueHTpMcbyr‘MposanM eme paa an 2000gn TeueHMe 10 MMH
`an 4 'C.n0quCHHy10 TaKMM ofipaaoM Cbmopmxy xpaHMJm um -60 “C. McnonbaoaaHMe CblBOpOTKH ame—
`CTO nJIaSMbI nm aHaJmaa III-1K KpoaM MOMCCT 6be5 onpannano. ech cofimoneHm ycnosml (bopMMpoaaHMsl
`Tp0M6a an KOMHa'rHofi Temneparype M HemenneHHoro omeneHMa cmaopoer o1- Tp0M6a (Icon et a1.,
`1977', Shapiro et al., 1983). 310 M 651110 BbIl’IOIIHBHO a Hamoamem MccnenoaaHMM.
`B nanhHeMLueM cuaopowxy nayxpamo ofipaGaTbIBanM (beuonom, cmechM dyeuona M xnopocbopma
`(1 : 1), mopocbopma M MaoaMMJloaoro chpTa (24 : 1) M ocamnanM aTaHonom an ~20 "C. I'Ipenapa'rbx
`LIHK aHaJIMSMpoBanM a l % -HOM araposnom rene, a 32mm McnonbaoaanM a xauecwae ManMubl an npoae—
`neHMM nonMMepasHoM uenHoM peaKuMM (I'IIIP).
`I'ILIP nposonmm c McnonbsoaaHMeM TepMOdJManOM IIHK-nonnmepaabl M3 Thermus thermophilus.
`Ocymecnamum 30—35 LLHKJ'IOB amnnMCbMKauMM. AMrdeJMLLMpychxe tbparMCH-rbx aHaJmsMpoaanM B
`8 "/n ~HOM I'IAAI‘. TemnepaTypa oanra npaMMepoa CDCTaBmma 55 ”C 11119! npafimepon BI M C2 M 60 “C mm
`npafimepa Tc65, KOHLIEHTpauHfl HOHOB Mg“ — 2—5 mM. HpaMMepr mu I‘ILIP 6131.71" CMH-reauponanu
`HaMM Taepnodoaanbm ¢oc¢anM3¢MpHmM meronom a fl—uMaHoa-rMmaHoM monMdJMKauMM Ha npuéope
`Gene assembler (bMprl Pharmacia. Hocnenoaarenbnocn npafimepa Tc65 333m M3 JIM-repaTypme Mc-roq~
`HMKOB (Nelson et al., 1989) , nocnenoaa'renbuocm OCTaJIbeIX npai’mepoa Hafinenbl an nomomM nporpaM-
`Mb] Oligo (Microsoft) no KOHceHcyaJIbHoM nocnenoaarenbuocm Alu—nosmpos MF ceMEMCTBa M 0603mm:-
`Hbl HaMM KaK B1 M C2.
`IIpM I‘IPOBCAEHMM HHP c napofi npafimepoa Bl M C2 B peBynLTaTe peaKuMM aMMMdJMuMponancn
`AJu—noaTop nnMHoM 239 nap ocuosaHMM. l'IpM McnonbaonaHMM a 1111? 70mm 011mm npafmepa T065 aM—
`mnchuMponaJlMCb tbpamem‘bl lIHK, dJnaHKMposaHx-lble AByMfi Alu—nonTopaMM, ofipameHthMM npyr K
`npyry 3’-K0HueablMM ofinacmMM (MHTefi-Mu-nomopaMM).
`Hocnenonarenbuocm npafimepos:
`
`Tc65—5'—AAGTCGCGGCCGCTTGCAGTGAGCCGAGA—3 ’
`B1—5’—CCTGTAATCCCAGCACTTTGG GAGGC—S’
`
`c2—5'—CCCAGGchGAGTGcé GTGG—S’
`
`PCSyflb’l‘aTbl M oficymleHMe
`
`B paéore MbI He CTanMnM uenmo 1161311131106 MsyueHMe M3MeHeHHfi KonueHTpa-
`um? HHK B cmnoporxe KpOBM 6epemeHme )KCHDIPIH. Ho AaHHbIM aBTOPOB, ncnonb—
`syloumx paRHOHMMYHOJIOFH‘IeCKHe MCTOIIbI onpenenenng (Leon el 31., 1977;
`Shapiro et 31., 1983), Kouuempannn HHK B cnmoporxax Kponn snoponhlx nonopos
`Kone6anaCb 0T 0 110 0.1 MKF/MJU' no nannhm aBTopOB, Mcnonbaylonmx 6M0x1mn—
`
`233
`
`Ariosa Exhibit 1034, pg. 12
`|PR2013-00277
`
`Ariosa Exhibit 1034, pg. 12
`IPR2013-00277
`
`

`

`qecxne meronu (Anker et 31., 1975; Stroun et 31., 1987), — GT 0.1 110 0.6 MKP/MJI.
`Hanna name 0 KameHTpaum III-1K B Kponn Myxvmn n Heéepemenrmx xemman
`COOTBCTCTBOBZUIE MTepaTypHmM.
`Ho nonyquHHM 11am naaHHM, 11pm 6epeMeHHOC'I‘El B 116me ouepem: ynema—
`unsaeTcs KeanenTpalmg Husxomonexympnofi HHK, upnueM HaHGOJ'ICC BblpaPKCHO
`yBeJImeHne 11pm recroae. Pasmepm TaKofi HHK cocrasmm GT 150 110 2500 nap
`ocaonaflm'i. Cymecrnye’r Touxa spemm o TOM,
`l1T0 yBcnnuenne KeaneHTpamm
`maxomonexyngpnofi BHeKJIeTouIIofi ILHK B KpOBEl 511111519;ng cnchTBECM ycwlemm
`CHHTCBa 31<crpaxp0Moc0MHofi IIHK (Bnazmrmpon n np., 1992). OnnaKo npn 0116B—
`Ke npenc'rannennmx naflmax 3606xonmao y‘lHTbmaTb, ‘ITO 11pm fiepeMcHHocm r116—
`neT BHaWTeHLHOC xomuecrno KJICTOK SHIIOMCTPEISI, oco6enno B Korma GepemeH—
`110mm 121 B cassn c rccrosoM (K011101321 121 up., 1989; Mnxafmoa 11 up, 1992a). Ho
`1131mm naHHLIM, 112163111: neumxyamxmx KJICTOK conponoquaeTcn noc'reneunofi no-
`Tepefi smepnofz ILHK 11 dapamemanuefi nepndmpnuecxux uaCTefi map 11 marro—
`Imaawrm KJICTOK n, no-BmmMOMy, nponcxonm uyTeM anonToaa (Mnxafmon {1 1m,
`1992a, 19926; Mnxafinos, 1993). 01mm 113 nenymnx MexaanaMon 111661111 KJ'ICTOK
`no T-y anonToaa manners; MCXHymeocomiag nerpanarmsx ZIHK BCJICIICTBHC
`aKTHBallEJZI Ca2*—311110131y1u1€:asm (Wyllic, 1980). CKaaaHHoe He ncmxoqaeT 303—
`MOXKHOCTEI axcrpaxpomocomnoro Kounposaaml HHK xaK acroqnnxa BuexneTouHofi
`IIHK Kponu. Heaanncnmo 0T TOI‘O, annseTca 1m HCToanKOM BHexJIeTquofi JIHK
`Kpoxm~ ycmenmfi CEIHTCB excrpaxpomocomnofi IIHK mm anonmttecxaa 11166er
`KJICTOK, Hanmme B Hefi Alu-IIOBTOpOB CBHJICTCJILCTByeT 0 ea smepHOM nponcxoxc—
`2161mm (puc. 1; CM. 13101. VIII).
`_
`‘
`O6pamae‘r Ba (3665! Emmanuc HpucyTCTBnc cpclm HHK CmepOTKH KpOBH 6e—
`pemeanux xemmm maTep—Alu—uonTopoa. I/Issecmo, L1T0 cpenn Alu-IIOBTOPOB qe-
`nonexa npmepao TpeTba uac'rb npnnamlexm 1< unnepTuponaHHHM HOBTopaM,
`14
`cpenaee paccrosnme mexny unneprmponaummm napamn cocmBJmCT IIDHMCPHO
`50 T. 11. H.
`(Jclinek, Schmid, 1982). OCHOBHaSI macca TaKEX namepmponarmux
`nosropon conepxm, no-BmmMOMy, ynuxanmmfi BHyTpemmfi (pparMCHT. Cyme—
`c'rByeT HCCKOJILKO 81111013 EHTep-Alu-HOBTOPOB. Hpn 11011011111 upai‘mepa Tc65 Mm
`oSnapyxmm HHTep-Alu-IIOBTODH B Kponn y xemmm 'I‘OJIbKO I TpflMCC'I‘pa 6epe—
`MeHHOCTn (pnc. 2). l'Ipn nponenemm IILIP c upafiMepOM Tc65 alvmjmtbmmpymTcx
`TOJILKO Te (bpameHTH IIHK, 11 KOTOprX cueficepnaa )lHK dmanxuposana Alu—no—
`BTopaMH, naamvmo ofipamemahmu npyr‘ K npyry 3'—0611aCTsIMH, qTo nwaeT 3TH
`quameHTm eme Gonee YHHKaJ'IbHHMH. TaKnM o6paaoM, ecnn 1121111111216 13 Kpom
`GepeMemmx xennmn yBennueHHom KonmecTBa Hnsxomonexympnmx dnpamea—
`TOB ,[LHK annaercs npoasneauem ycunemaofi KJICTo‘mofi FHGBJEH, meromefi McCTo _
`B MaTKe Ha Bcex cpoxax éepeMCHHocm, TO upncyTCTBue miTep-Alu-noaTopon
`yxaahmae'r Ha (bynxnnoxmposanne npymx mexaansmon HOCI‘YHJICHPISI TaKHX no—
`cnenonaTenbnoc'refi B KpOBOTOK. Baxao, ‘{T0 nHTep-Alu-uos'ropbl 6mm 06Hapy>1<e—
`ELI TOJIbKO B Kpona XBHIIIELH I TpmaeCTpa SepeMexmoc'm. 3T0T (ban, cxopee BCCI‘O,
`mpaxae'r paaxmme 1; conepxamm ueTquux nponeccos, xapamepmx 111151 pau-
`me 121 110310117111 cramzrfi 6cpcme1moc1‘n. E01171 B 1(0an 6CDCMCHHOCTH 11a61110nae'rca
`11466111) neunuyamaumx KneTox, qu ofimcaseTcg YBBJIKHCHBCKOHILCHTpaHHH 11113—
`Komonexympaofi HHK B KpOBH, T0 1; HallaJILI-IOM nepnone fiepeMeHHOCTn, Kama
`[IpOHCXDlISIT nmmamaunn 1a 11113116111311.1151 sapoxmma B MaTKc, mam MCCTO ne—
`Imzxyannsaum atmome'rpna 11 pOCT 111101111010 Hyampa, T. e. uponecc Jamaaepemm-
`posxn KJICTOK cmsuc'rofi 14mm 11 KJICTOK Tpoq’ofinacra.
`Bepox'rflo, Ba paHan crammx 6epcmcnnocm UponcxmmT sxcxpcmm