The Ne w E n g l a nd Jo u r n a l o f Me d ic i ne
`
`PRENATAL DIAGNOSIS OF FETAL RhD STATUS BY MOLECULAR ANALYSIS
`
`OF MATERNAL PLASMA
`
`Y.M. D
` H
`, M.R.C.P., N. M
` L
` F
`., C
`, F.R.C.P
`, P
` L. S
`.D., I
`, P
`ENNIS
`AGNUS
`O
`IDLER
`ARRIE
`ATH
`JELM
`H
`ARGENT
`AN
`H
`M
` F. M
`, F.R.C.P
`., P
` F. C
`, M.D., P
` M.K. P
`, P
`.D.,
`HAMBERLAIN
`URPHY
`ICHAEL
`ATH
`AUL
`OON
`RISCILLA
`H
`C
` W.G. R
`, F.R.C.P.,
` J
` S. W
`, F.R.C.P
`.
`HRISTOPHER
`EDMAN
`AMES
`AINSCOAT
`ATH
`
`AND
`
`.D.,
`
`A
`BSTRACT
`Background
`The ability to determine fetal RhD
`status noninvasively is useful in the treatment of
`RhD-sensitized pregnant women whose partners are
`heterozygous for the
` gene. The recent demon-
`RhD
`stration of fetal DNA in maternal plasma raises the
`possibility that fetal RhD genotyping may be possi-
`ble with the use of maternal plasma.
`Methods
`We studied 57 RhD-negative pregnant
`women and their singleton fetuses. DNA extracted
`from maternal plasma was analyzed for the
`RhD
`gene with a fluorescence-based polymerase-chain-
`reaction (PCR) test sensitive enough to detect the
` gene in a single cell. Fetal RhD status was de-
`RhD
`termined directly by serologic analysis of cord blood
`or PCR analysis of amniotic fluid.
`Results
`Among the 57 RhD-negative women, 12
`were in their first trimester of pregnancy, 30 were in
`their second trimester, and 15 were in their third tri-
`mester. Thirty-nine fetuses were RhD-positive, and
`18 were RhD-negative. In the samples obtained from
`women in their second or third trimester of preg-
`nancy, the results of RhD PCR analysis of maternal
`plasma DNA were completely concordant with the re-
`sults of serologic analysis. Among the maternal plas-
`ma samples collected in the first trimester, 2 contained
` DNA, but the fetuses were RhD-positive; the
`no
`RhD
`results in the other 10 samples were concordant
`(7 were RhD-positive, and 3 RhD-negative).
`Conclusions
`Noninvasive fetal RhD genotyping
`can be performed rapidly and reliably with the use
`of maternal plasma beginning in the second trimes-
`ter of pregnancy. (N Engl J Med 1998;339:1734-8.)
`©1998, Massachusetts Medical Society.
`
`T
`
`HE Rh blood-group system is involved in
`hemolytic disease of the newborn, transfu-
`sion reactions, and autoimmune hemolytic
`anemia.
` Despite the widespread use of Rh
`1
`immune globulin prophylaxis in RhD-negative preg-
`nant women, Rh isoimmunization still occurs.
` In
`2
`cases in which the father is heterozygous for the
` gene, and the mother is RhD-negative, there is
`RhD
`a 50 percent chance that the child will be RhD-pos-
`itive. Prenatal determination of RhD status in these
`cases is clinically useful because no further testing or
`therapeutic procedures will be necessary if the fetus
`is RhD-negative. If the fetus is RhD-positive, fur-
`
`1734
`
`·
`
`De c e m b e r 10 , 19 9 8
`
`ther studies will be necessary to determine the level
`of fetal hemolysis (e.g., by fetal-blood sampling).
` has been cloned, and it is
`The human
` gene
`RhD
`3
`absent in RhD-negative subjects.
` Fetal RhD status
`4
`has been determined in samples of amniotic fluid
`and chorionic villi with the use of techniques based
` However,
`on the polymerase chain reaction (PCR).
`5
`because of the invasive means by which such samples
`are obtained, these approaches increase the risk of
`further sensitizing the mother. To circumvent this
`risk, several groups have investigated the possibility
`of determining fetal RhD status through the use of
`fetal cells isolated from maternal blood.
` The main
`6-9
`problem with this approach is that the procedures
`needed to isolate sufficient numbers of fetal cells
`from maternal blood are time consuming, technical-
`ly demanding, and expensive.
` An alternative ap-
`7,8
` messenger
`proach based on the detection of
`RhD
`RNA in fetal nucleated red cells has also been de-
`scribed,
` but the small number of subjects analyzed
`10
`precludes any firm conclusion as to the reliability of
`this method.
`In a recent study, we identified fetal DNA in ma-
` Therefore, in the current
`ternal plasma and serum.
`11
`study, we assessed the feasibility of fetal RhD geno-
`typing using fetal DNA extracted from plasma sam-
`ples from RhD-negative pregnant women.
`
`METHODS
`
`Subjects
`
`We collected 10-ml blood samples from 30 blood donors who
`were positive on serologic testing for RhD and 30 blood donors
`who were negative at the Department of Hematology, John Rad-
`cliffe Hospital, Oxford, United Kingdom. We used these samples
`to establish the accuracy of the RhD PCR system.
`To assess the value of the system for prenatal diagnosis, we col-
`lected 10-ml blood samples from 57 women with singleton preg-
`nancies who were patients at the Nuffield Department of Obstet-
`rics and Gynecology, John Radcliffe Hospital. Twelve women
`were in the first trimester of pregnancy (7 to 14 weeks), 30 were
`in the second trimester (15 to 23 weeks), and 15 were in the third
`trimester (37 to 41 weeks). Ten were primigravidas. The blood
`samples were collected from the women who were in the first tri-
`mester of pregnancy during a routine prenatal checkup. Blood
`
`From the Department of Chemical Pathology, Chinese University of
`Hong Kong, Prince of Wales Hospital, Hong Kong, China (Y.M.D.L.,
`N.M.H., P.M.K.P.); and the Department of Hematology (C.F., M.F.M.,
`J.S.W.) and the Nuffield Department of Obstetrics and Gynecology (I.L.S.,
`P.F.C., C.W.G.R.), John Radcliffe Hospital, Oxford, United Kingdom. Ad-
`dress reprint requests to Dr. Lo at the Department of Chemical Pathology,
`Rm. 38023, Clinical Sciences Bldg., Prince of Wales Hospital, 30–32 Ngan
`Shing St., Hong Kong, China.
`
`The New England Journal of Medicine
`Downloaded from nejm.org on May 7, 2012. For personal use only. No other uses without permission.
` Copyright © 1998 Massachusetts Medical Society. All rights reserved.
`
`Ariosa Exhibit 1037, pg. 1
`IPR2013-00277
`
`

`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`P R E N ATA L D I AG N O S I S O F F ETA L R h D STAT U S BY M O L EC U L A R A N A LYS I S O F M AT E R N A L P L AS M A
`
`samples from the women in their second trimester were collected
`just before routine amniocentesis; 10 ml of amniotic fluid was
`also collected for fetal RhD genotyping. The blood samples were
`collected from the women in their third trimester just before de-
`livery. For the women who were studied during the first and third
`trimesters, a sample of cord blood was collected after delivery for
`the determination of fetal RhD status by serologic methods. The
`project was approved by the Central Oxfordshire Research Ethics
`Committee, and all the women gave informed consent.
`
`Preparation of Samples
`
`The blood samples were collected in tubes containing EDTA
`and centrifuged at 3000¬
`, and the plasma was then transferred
`g
`into plain polypropylene tubes, with care taken to ensure that the
`buffy coat was not disturbed. The buffy coat was then removed
`and stored at ¡20°C until further processing. The plasma sam-
`ples were recentrifuged at 3000¬
` and the supernatants were
`g,
`stored at ¡20°C until further processing.
`
`DNA Extraction
`
`DNA was extracted from samples of plasma (800 µl), buffy
`coat, and amniotic fluid (200 µl each) with a QIAamp Blood Kit
`(Qiagen, Hilden, Germany) according to the “blood and body
`fluid protocol” recommended by the manufacturer.
` An elution
`12
`volume of 50 µl was used for the final washing of the DNA from
`the column.
`
`Real-Time Fluorogenic PCR Analysis
`
`Real-time fluorogenic PCR analysis was performed with a Per-
`kin–Elmer Sequence Detector (model 7700, Perkin–Elmer Ap-
`plied Biosystems, Foster City, Calif.), which is a combined ther-
`mal cycler and fluorescence detector with the ability to monitor
` The RhD
`the progress of individual PCR reactions optically.
`13
`fluorogenic PCR system consisted of the amplification primers
`RD-A (5'CCTCTCACTGTTGCCTGCATT3') and RD-B (5'AG-
`TGCCTGCGCGAACATT3') and a dual-labeled fluorescent probe,
`RD-T (5'(FAM)TACGTGAGAAACGCTCATGACAGCAAAG-
`TCT(TAMRA)3'; FAM [6 carboxyfluorescein] and TAMRA
`[6 carboxytetramethylrhodamine] were the fluorescent reporter
`dye and quencher dye, respectively).
` The primers and probe
`13
`were targeted toward the 3' untranslated region (exon 10) of the
` gene.
` The
`-globin PCR system consisted of the amplifi-
`RhD
`3
`b
`cation primers and probe as previously described.
` The fluores-
`14
`cent probes contained a 3'-blocking phosphate group to prevent
`extension of the probe during the PCR. Combinations of primers
`and probes were designed with Primer Express software (Perkin–
`Elmer). Sequence data for the
` gene were obtained from the
`RhD
`GenBank data base (accession number, X63097).
`The fluorogenic PCR reactions were set up according to the
`manufacturer’s instructions in a reaction volume of 50 µl with all
`components except the fluorescent probes and amplification prim-
`ers obtained from a TaqMan PCR Core Reagent Kit (Perkin–
`Elmer). The RhD and
`-globin fluorescent probes were custom-
`b
`synthesized by Perkin–Elmer and were used at concentrations of
`25 nM and 100 nM, respectively. The PCR primers were synthe-
`sized by Life Technologies (Gaithersburg, Md.) and were used at
`a concentration of 300 nM. A total of 5 µl of the extracted plas-
`ma or amniotic fluid DNA was used for amplification; for buffy-
`coat DNA, 10 ng was used. DNA amplifications were carried out
`in 96-well reaction plates that were designed to capture optical
`data (Perkin–Elmer).
`Thermal cycling was initiated with a two-minute period of in-
`cubation at 50°C to allow time for the enzyme uracil
`-glycosy-
`N
`lase, which destroys any contaminating PCR amplicons, to act.
`This step was followed by initial denaturation for 10 minutes at
`95°C and then by 40 cycles of denaturation at 95°C for 15 sec-
`onds and reannealing and extension for 1 minute at 60°C.
`Amplification data collected by the Sequence Detector and stored
`in a Macintosh computer (Apple, Cupertino, Calif.) were ana-
`lyzed with Sequence Detection System software (Perkin–Elmer).
`
`The threshold of detection was set at 10 SD above the mean base-
`line fluorescence calculated from cycles 1 to 15.
` An amplification
`13
`reaction in which the intensity of fluorescence increased above the
`threshold during the course of thermal cycling was defined as a
`positive reaction.
`
`Anticontamination Measures
`
`Strict precautions against contamination of the PCR assay were
`used.
` Aerosol-resistant pipette tips were used to handle all liquids.
`15
`Separate areas were used to set up amplification reactions, add
`DNA template, and carry out amplification reactions. The use of
`the Sequence Detector offered an extra level of protection in that
`its optical-detection system obviated the need to reopen the reac-
`tion tubes after the completion of the amplification reactions, thus
`minimizing the possibility of carryover contamination. In addi-
`tion, the PCR assay included a further anticontamination measure
`in the form of preamplification treatment with uracil
`-glycosy-
`N
`lase, which destroyed uracil-containing PCR products.
` Multiple
`16
`water blanks were included as negative controls in every analysis.
`
`RESULTS
`
`The RhD PCR system was used to genotype
`buffy-coat DNA extracted from the 30 RhD-posi-
`tive blood donors and the 30 RhD-negative blood
`donors. There was complete concordance between
`the results of RhD PCR genotyping and the sero-
`logic results.
`To determine the sensitivity of fluorogenic RhD
`PCR analysis, genomic DNA from an RhD-positive
`subject was diluted serially both in water and in 1 µg
`of genomic DNA from an RhD-negative subject.
`The smaller the amount of DNA, the more ampli-
`fication cycles were needed to produce detectable
`amounts of fluorescent reporter molecules (Fig. 1).
`Positive signals were detected with as little DNA as
`the approximate amount (7.8 pg) contained in a sin-
`gle RhD-positive cell.
`All 57 of the pregnant women were RhD-negative
`on serologic testing. Analysis of DNA extracted from
`buffy-coat samples from the 45 women who were in
`the second or third trimester of pregnancy revealed
`no
` DNA, a finding in agreement with the se-
`RhD
`rologic results. Among the 57 fetuses, 39 were RhD-
`positive and 18 were RhD-negative on serologic
`analysis of cord blood or PCR testing of amniotic
`fluid.
`The results of the RhD PCR assay of plasma sam-
`ples from the 57 women are shown in Table 1. Rep-
`resentative amplification data are shown in Figure 2.
`Among the women who were in the second or third
`trimester of pregnancy, there was complete concord-
`ance between results of the fetal RhD genotyping
`with use of the RhD PCR assay of maternal plasma
`samples and the results obtained from genotyping of
`amniotic fluid or serologic testing of cord blood.
`Plasma samples from two women in the first trimes-
`ter of pregnancy who were carrying RhD-positive
`fetuses, with gestational ages of eight and nine
`weeks, yielded false negative results. The results in
`the other 10 women in their first trimester of preg-
`nancy were concordant: 7 were RhD-positive on PCR
`
`Vo l u m e 3 3 9 Nu m b e r 2 4
`
`·
`
`1735
`
`The New England Journal of Medicine
`Downloaded from nejm.org on May 7, 2012. For personal use only. No other uses without permission.
` Copyright © 1998 Massachusetts Medical Society. All rights reserved.
`
`Ariosa Exhibit 1037, pg. 2
`IPR2013-00277
`
`

`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`The Ne w E n g l a nd Jo u r n a l o f Me d ic i ne
`
`500 pg of DNA
`250 pg of DNA
`125 pg of DNA
`62.5 pg of DNA
`31.3 pg of DNA
`15.6 pg of DNA
`7.8 pg of DNA
`
`10
`
`20
`
`30
`
`40
`
`Amplification Cycle
`
`2.5
`
`2.0
`
`0.5
`
`1.0
`
`0.5
`
`Intensity of Fluorescence
`
`0.0
`
`0
`
` Sensitivity of the PCR Analysis for the Detection of
`Figure 1.
`
` DNA.
`RhD
`
`Genomic DNA from an RhD-positive subject was serially diluted and subjected to real-time fluorogenic
`RhD PCR analysis. The intensity of fluorescence was monitored optically during each amplification cy-
` With progressively fewer target molecules, more cycles of amplification were required to achieve
`cle.
`13
`a detectable level of fluorescence. The final dilution (7.8 pg) corresponded to the approximate DNA
`content of a single cell.
`
`testing and had RhD-positive fetuses, and 3 were
`RhD-negative on PCR testing and had RhD-nega-
`tive fetuses. Forty-seven of the 57 subjects had had
`previous pregnancies.
`As a control for the amplifiability of DNA extract-
`ed from maternal plasma, the samples were also sub-
`-globin PCR assay. The signal was
`jected to the
`b
`positive in all 57 samples of maternal plasma DNA.
`
`DISCUSSION
`
`Our study demonstrates the feasibility of fetal
`RhD genotyping with the use of DNA extracted
`from maternal plasma. This type of analysis should
`be very useful for the treatment of sensitized RhD-
`negative women whose partners are heterozygous
`for the
` gene. If testing shows that the fetus is
`RhD
`RhD-negative, the parents can be reassured that the
`fetus is not at risk. On the other hand, if testing
`shows that the fetus is RhD-positive, treatment can
`be planned. The advantage of this test, which ana-
`lyzes maternal plasma, is that neither the mother nor
`the fetus is exposed to the risks normally associated
`with amniocentesis or chorionic-villus sampling.
`17
`An additional important advantage of this approach
`is the avoidance of further immunologic sensitiza-
`tion as a result of fetomaternal hemorrhage after in-
`vasive procedures.
`
`18,19
`Our data suggest that the results of the RhD PCR
`test are reliable beginning in the second trimester.
`The availability of such early, reliable results gives
`clinicians sufficient time to plan for further tests or
`treatment such as fetal-blood sampling and fetal
` which are usually performed begin-
`transfusion,
`20,21
`ning in the middle of the second trimester. The re-
`sults for two first-trimester samples were false nega-
`tive, presumably because of the low concentration of
`fetal DNA in maternal plasma at that time.
`
`14
`This test may also have an application in the rou-
`tine testing of nonsensitized RhD-negative pregnant
`
`T
`OF
`
`ABLE
` F
`
`WITH
`
`
` RhD G
`
`ENOTYPING
`OF
`ESULTS
` W
`
`
` RhD-N
`OMEN
`EGATIVE
`
` RhD PCR A
`.*
`SE
`OF
`THE
`
`OF
`
`
`SSAY
`
` 1.
` R
`ETUSES
` U
`
`THE
`
`T
`
`RIMESTER
`P
`REGNANCY
`
`OF
`
`RhD-P
`OSITIVE
`F
`†
`ETUS
`
`RhD-N
`EGATIVE
`F
`†
`ETUS
`
`no. of positive fetuses on PCR
`testing/total no. of fetuses (%)
`
`First
`
`Second
`
`Third
`
`7/9 (78)
`
`22/22 (100)
`
`8/8 (100)
`
`0/3
`
`0/8
`
`0/7
`
`*The RhD PCR assay used plasma samples from
`the women.
`
`†The RhD status was determined by serologic
`analysis of cord-blood samples in the case of samples
`obtained during the first or third trimester and by
`PCR testing of amniotic fluid in the case of samples
`obtained during the second trimester.
`
`1736
`
`·
`
`De c e m b e r 10 , 19 9 8
`
`The New England Journal of Medicine
`Downloaded from nejm.org on May 7, 2012. For personal use only. No other uses without permission.
` Copyright © 1998 Massachusetts Medical Society. All rights reserved.
`
`Ariosa Exhibit 1037, pg. 3
`IPR2013-00277
`
`

`
`P R E N ATA L D I AG N O S I S O F F ETA L R h D STAT U S BY M O L EC U L A R A N A LYS I S O F M AT E R N A L P L AS M A
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`Subject 1 (15 wk of gestation)
`Subject 2 (16 wk of gestation)
`Subject 3 (15 wk of gestation)
`Subject 4 (15 wk of gestation)
`Subject 5 (39 wk of gestation)
`Subject 6 (10.5 wk of gestation)
`
`10
`
`20
`
`30
`
`40
`
`Amplification Cycle
`
`0.6
`
`0.4
`
`0.2
`
`Intensity of Fluorescence
`
`0.0
`
`0
`
`Figure 2. Detection of Fetal RhD DNA in Maternal Plasma.
`
`DNA extracted from plasma samples from six pregnant women was analyzed with the RhD PCR sys-
`tem. Subjects 1, 2, 4, 5, and 6 were carrying RhD-positive fetuses and had positive amplification sig-
`nals, corresponding to the presence of fetal DNA in maternal plasma. Subject 3 was carrying an RhD-
`negative fetus, and there was no amplification signal.
`
`women. If the fetus is found to be RhD-negative,
`then unnecessary use of RhD immune globulin can
`be avoided.
`
`22
`From the data obtained so far, analysis of fetal
`DNA in maternal plasma does not appear to be af-
`fected by the persistence of fetal cells from previous
`pregnancies.
` For example, we found no false posi-
`23
`tive results in plasma from women who had been
`pregnant before and who were carrying RhD-nega-
`tive fetuses in the current pregnancy. This finding is
`consistent with our previous data obtained using
`Y-chromosome–specific PCR testing: there were no
`false positive results in women who had previously
`been pregnant with a male fetus.
`
`14
`Because of the high concentration of fetal DNA
`in maternal plasma,
` the results of fetal genotyping
`14
`of DNA extracted from maternal plasma are more
`reliable than those obtained by fetal genetic analysis
`of the cellular fraction of maternal blood. It also
`does not rely on the isolation of fetal cells, which re-
`quires the use of specialized, time-consuming, and
`technically demanding techniques such as cell sort-
` The high sensitivity
` and micromanipulation.
`ing
`25
`24
`of our PCR system is most likely the result of the
`use of an efficient protocol for the extraction of
`DNA and a fluorescence-based DNA system of am-
`plification detection. Our current protocol for the
`extraction of DNA allows us to use eight times as
`much plasma DNA per amplification as was used in
`
`our previous study.
`11
`
`The method that we used has a number of advan-
`tages. First, it is based on an optical system of detec-
`tion that obviates the need for any postamplification
`manipulation or analysis of samples. Second, the sys-
`tem is efficient, because the amplification and prod-
`uct-detection steps are combined. This allows 96
`samples to be analyzed within a period of two hours.
`Even when one factors in the time needed to extract
`DNA from plasma, this method of fetal genotyping
`can easily be performed in one day. The brevity of
`this method should facilitate efficient clinical deci-
`sion making and decrease the time that sensitized
`RhD-negative women spend waiting to learn the
`RhD status of their fetuses.
`The Rh family of polypeptides is encoded by two
`related genes: the
` gene and the
` gene.
`RhCE
`RhD
`3,26
`Because of the genetic complexity of the Rh system,
`several primer sets have been described for use in
` The extent of agreement be-
`RhD genotyping.
`5,6,27
`tween the results of genotyping and serologic results
`is high, although the results can be discordant, pos-
`sibly because of the existence of uncommon poly-
`
`morphisms.
`27
`Our findings indicate that the results of genotyping
`of fetal DNA extracted from maternal plasma are ac-
`curate and can potentially be used for the diagnosis
`of many disorders involving single genes. This ap-
`proach may also be used to identify disorders such as
`-thalassemia in families in which
`cystic fibrosis and
`b
`the father and mother carry different mutations.28
`
`Vo l u m e 3 3 9 Nu m b e r 2 4
`
`·
`
`1737
`
`The New England Journal of Medicine
`Downloaded from nejm.org on May 7, 2012. For personal use only. No other uses without permission.
` Copyright © 1998 Massachusetts Medical Society. All rights reserved.
`
`Ariosa Exhibit 1037, pg. 4
`IPR2013-00277
`
`

`
`The Ne w E n g l a nd Jo u r n a l o f Me d ic i ne
`
`Drs. Lo and Hjelm are supported by the Hong Kong Research Grants
`Council.
`Drs. Lo and Wainscoat have applied for a patent for the RhD test pro-
`cedure described in this paper.
`
`We are indebted to J. Zhang for technical help.
`
`REFERENCES
`
`1. Mollison PL, Engelfriet CP, Contreras M. Blood transfusion in clinical
`medicine. 9th ed. Oxford, England: Blackwell Scientific, 1993:204-45.
`2. Clarke CA, Whitfield AG, Mollison PL. Deaths from Rh haemolytic
`disease in England and Wales in 1984 and 1985. BMJ 1987;294:1001.
`3. Le Van Kim C, Mouro I, Chérif-Zahar B, et al. Molecular cloning and
`primary structure of the human blood group RhD polypeptide. Proc Natl
`Acad Sci U S A 1992;89:10925-9.
`4. Colin Y, Chérif-Zahar B, Le Van Kim C, Raynal V, Van Huffel V, Car-
`tron J-P. Genetic basis of the RhD-positive and RhD-negative blood group
`polymorphism as determined by Southern analysis. Blood 1991;78:2747-
`52.
`5. Bennett PR , Le Van Kim C, Colin Y, et al. Prenatal determination of
`fetal RhD type by DNA amplification. N Engl J Med 1993;329:607-10.
`6. Lo YMD, Bowell PJ, Selinger M, et al. Prenatal determination of fetal
`RhD status by analysis of peripheral blood of rhesus negative mothers.
`Lancet 1993;341:1147-8.
`7. Geifman-Holtzman O, Bernstein IM, Berry SM, et al. Fetal RhD geno-
`typing in fetal cells flow sorted from maternal blood. Am J Obstet Gynecol
`1996;174:818-22.
`8. Sekizawa A, Watanabe A, Kimura T, Saito H, Yanaihara T, Sato T. Pre-
`natal diagnosis of the fetal RhD blood type using a single fetal nucleated
`erythrocyte from maternal blood. Obstet Gynecol 1996;87:501-5.
`9. Toth T, Papp C, Toth-Pal E, Nagy B, Papp Z. Fetal RhD genotyping by
`analysis of maternal blood: a case report. J Reprod Med 1998;43:219-22.
`10. Hamlington J, Cunningham J, Mason G, Mueller R , Miller D. Prena-
`tal detection of rhesus D genotype. Lancet 1997;349:540.
`11. Lo YMD, Corbetta N, Chamberlain PF, et al. Presence of fetal DNA
`in maternal plasma and serum. Lancet 1997;350:485-7.
`12. Chen XQ, Stroun M, Magnenat J-L, et al. Microsatellite alterations in
`plasma DNA of small cell lung cancer patients. Nat Med 1996;2:1033-5.
`13. Heid CA, Stevens J, Livak KJ, Williams PM. Real time quantitative
`PCR. Genome Res 1996;6:986-94.
`
`14. Lo YMD, Tein MSC, Lau TK, et al. Quantitative analysis of fetal
`DNA in maternal plasma and serum: implications for noninvasive prenatal
`diagnosis. Am J Hum Genet 1998;62:768-75.
`15. Kwok S, Higuchi R. Avoiding false positives with PCR. Nature 1989;
`339:237-8. [Erratum, Nature 1989;339:490.]
`16. Longo MC, Berninger MS, Hartley JL. Use of uracil DNA glycosylase
`to control carry-over contamination in polymerase chain reactions. Gene
`1990;93:125-8.
`17. The Canadian Collaborative CVS-Amniocentesis Clinical Trial Group.
`Multicentre randomised clinical trial of chorion villus sampling and amnio-
`centesis: first report. Lancet 1989;1:1-6.
`18. Blakemore KJ, Baumgarten A, Schoenfeld-Dimaio M, Hobbins JC,
`Mason EA, Mahoney MJ. Rise in maternal serum alpha-fetoprotein con-
`centration after chorionic villus sampling and the possibility of isoimmuni-
`zation. Am J Obstet Gynecol 1986;155:988-93.
`19. Tabor A, Bang J, Norgaard-Pedersen B. Feto-maternal haemorrhage
`associated with genetic amniocentesis: results of a randomized trial. Br J
`Obstet Gynaecol 1987;94:528-34.
`20. Dildy GA, Jackson GM, Ward K. Determination of fetal RhD status
`from uncultured amniocytes. Obstet Gynecol 1996;88:207-10.
`21. Schumacher B, Moise KJ Jr. Fetal transfusion for red blood cell alloim-
`munization in pregnancy. Obstet Gynecol 1996;88:137-50.
`22. Robson SC, Lee D, Urbaniak S. Anti-D immunoglobulin in RhD pro-
`phylaxis. Br J Obstet Gynaecol 1998;105:129-34.
`23. Bianchi DW, Zickwolf GK, Weil GJ, Sylvester S, DeMaria MA. Male
`fetal progenitor cells persist in maternal blood for as long as 27 years post-
`partum. Proc Natl Acad Sci U S A 1996;93:705-8.
`24. Bianchi DW, Flint AF, Pizzimenti MF, Knoll JH, Latt SA. Isolation of
`fetal DNA from nucleated erythrocytes in maternal blood. Proc Natl Acad
`Sci U S A 1990;87:3279-83.
`25. Cheung MC, Goldberg JD, Kan YW. Prenatal diagnosis of sickle cell
`anaemia and thalassaemia by analysis of fetal cells in maternal blood. Nat
`Genet 1996;14:264-8.
`26. Chérif-Zahar B, Bloy C, Le Van Kim C, et al. Molecular cloning and
`protein structure of a human blood group Rh polypeptide. Proc Natl Acad
`Sci U S A 1990;87:6243-7.
`27. Aubin JT, Le Van Kim C, Mouro I, et al. Specificity and sensitivity of
`RhD genotyping methods by PCR-based DNA amplification. Br J Hae-
`matol 1997;98:356-64.
`28. Lo YMD, Fleming KA, Wainscoat JS. Strategies for the detection of
`autosomal fetal DNA sequence from maternal peripheral blood. Ann N Y
`Acad Sci 1994;731:204-13.
`
`1738 · De c e m b e r 10 , 19 9 8
`
`The New England Journal of Medicine
`Downloaded from nejm.org on May 7, 2012. For personal use only. No other uses without permission.
` Copyright © 1998 Massachusetts Medical Society. All rights reserved.
`
`Ariosa Exhibit 1037, pg. 5
`IPR2013-00277