111111111111111111111111111111111111111111111111111111111111111111111111111
`US008318430B2
`
`(12) United States Patent
`Chuu et al.
`
`(10) Patent No.:
`(45) Date of Patent:
`
`US 8,318,430 B2
`Nov. 27, 2012
`
`(54) METHODS OF FETAL ABNORMALITY
`DETECTION
`
`(75)
`
`Inventors: Yue-Jen Chuu, Cupertino, CA (US);
`Richard P. Rava, Redwood City, CA
`(US)
`
`(73) Assignee: Verinata Health, Inc., Redwood City,
`CA (US)
`
`( *) Notice:
`
`Subject to any disclaimer, the term of this
`patent is extended or adjusted under 35
`U.S.c. 154(b) by 0 days.
`
`(21) App!. No.: 13/368,035
`
`(22) Filed:
`
`Feb. 7,2012
`
`(65)
`
`Prior Publication Data
`
`US 2012/0135872 Al
`
`May 31,2012
`
`Related U.S. Application Data
`
`(63) Continuation of application No. 13/012,222, filed on
`Jan. 24, 2011.
`
`(60) Provisional application No. 611297,755, filed on Jan.
`23,2010.
`
`(51)
`
`Int. Cl.
`C12Q 1/68
`C12P 19/34
`(52) U.S. CI
`(58) Field of Classification Search
`See application file for complete search history.
`
`(2006.01)
`(2006.01)
`
`435/6.1; 435/91.2
`None
`
`(56)
`
`References Cited
`
`U.S. PATENT DOCUMENTS
`5,994,057 A
`III1999 Mansfield
`7/2001 Loetal.
`6,258,540 Bl
`10/2003 Mehta et al.
`6,632,655 Bl
`8/2005 Dennis et al.
`6,927,028 B2
`8/2007 Szasz
`7,252,946 B2
`7,332,277 B2
`2/2008 Dhallan
`7,442,506 B2
`10/2008 Dhallan
`9/2009 Oliphant et al.
`7,582,420 B2
`112010 Loetal.
`7,645,576 B2
`6/2010 Dhallan et al.
`7,727,720 B2
`9/2010 Mitchell et al.
`7,799,531 B2
`1112010 Hahn et al.
`7,838,647 B2
`2/2011 Quake et al.
`7,888,017 B2
`6/2011 Shen et al.
`7,955,794 B2
`8/2011 Shen et al.
`8,003,354 B2
`8/2011 Quake et al.
`8,008,018 B2
`3/2012 Stoughton et al.
`8,137,912 B2
`5/2012 Shoemaker et al.
`8,168,389 B2
`6/2012 Fan et al.
`8,195,415 B2
`12/2001 Lo et al.
`200110051341 Al
`10/2002 Wang et al.
`2002/0142324 Al
`1112002 Quake
`2002/0164816 Al
`112003 Balasubramanian
`2003/0022207 Al
`3/2003 Dennis et al.
`2003/0044388 Al
`10/2003 Penn et al.
`2003/0194704 Al
`7/2004 Dhallan
`2004/0137470 Al
`10/2004 Pinter et al.
`2004/0209299 Al
`9/2005 Quake et al.
`2005/0196785 Al
`10/2005 Shimkets et al.
`2005/0221341 Al
`1112005 McBride et al.
`2005/0252773 Al
`
`506/9
`
`2006/0046258 Al
`2006/0257895 Al
`2006/0286558 Al
`2007/0134658 Al
`2007/0202525 Al
`2007/0207466 Al
`2007/0275402 Al
`2008/0020390 Al
`2008/0050739 Al
`2008/0064098 Al
`2008/0070792 Al *
`2008/0071076 Al
`2008/0096216 Al
`2008/0138809 Al
`2008/0193927 Al
`2008/0220422 Al
`2008/0299562 Al
`2009/0029377 Al
`2009/0053719 Al
`2009/0087847 Al
`2009/0170114 Al
`2009/0215042 Al
`2009/0270601 Al
`2009/0299645 Al
`2009/0307181 Al
`2009/0317798 Al
`2009/0317817 Al
`2009/0317818 Al
`2010/0068711 Al
`2010/0093550 Al
`2010/0093835 Al
`2010/0112575 Al
`201 % 112590 Al
`2010/0136529 Al
`2010/0138165 Al
`2010/0167954 Al
`2010/0184075 Al
`2010/0216151 Al
`2010/0216153 Al
`2010/0304978 Al
`2010/0311064 Al
`201110027771 Al
`
`3/2006 Lapidus et al.
`1112006 Pinke! et al.
`12/2006 Novoradovskaya et al.
`6/2007 Bohmer et al.
`8/2007 Quake et al.
`9/2007 Cantor et al.
`1112007 Lo et al.
`1/2008 Mitchell et al.
`2/2008 Stoughton et al.
`3/2008 Allickson
`3/2008 Stoughton et al.
`3/2008 Hahn et al.
`4/2008 Quake
`6/2008 Kapur et al.
`8/2008 Mann et al.
`9/2008 Shoemaker et al.
`12/2008 Oeth et al.
`112009 Lo et al.
`2/2009 Lo et al.
`4/2009 Lo et al.
`7/2009 Quake et al.
`8/2009 Sella-Tavor et al.
`10/2009 Benner et al.
`12/2009 Colbyet al.
`12/2009 Colbyet al.
`12/2009 Heid et al.
`12/2009 Oeth et al.
`12/2009 Ehrich et al.
`3/2010 Umanskyetal.
`4/2010 Stuelpnagel et al.
`4/2010 McSwiggen et al.
`5/2010 Fan et al.
`5/2010 Lo et al.
`6/2010 Shoemaker et al.
`6/2010 Fan et al.
`7/2010 Earnshaw et al.
`7/2010 Cantor et al.
`8/2010 Lapidus et al.
`8/2010 Lapidus et al.
`12/2010 Deng et al.
`12/2010 Oliphant et al.
`2/2011 Deng et al.
`(Continued)
`
`EP
`
`FOREIGN PATENT DOCUMENTS
`0994963 Bl
`5/2003
`(Continued)
`
`OTHER PUBLICATIONS
`
`Illuminia. Multiplexed Sequencing with the Illumina Genome Ana(cid:173)
`lyzer System. Dec. 2, 2008. Illumina Sequecing. 4 pages.*
`
`(Continued)
`
`Primary Examiner -
`Jennifer Dunston
`Assistant Examiner - Channing S Mahatan
`(74) Attorney, Agent, or Firm - Wilson Sonsini Goodrich &
`Rosati
`
`(57)
`
`ABSTRACT
`
`Methods and kits for selectively enriching non-random poly(cid:173)
`nucleotide sequences are provided. Methods and kits for gen(cid:173)
`erating libraries ofsequences are provided. Methods ofusing
`selectively enriched non-random polynucleotide sequences
`for detection of fetal aneuploidy are provided.
`
`30 Claims, 28 Drawing Sheets
`
`Ariosa Exhibit 1001, p. 1
`
`

`

`US 8,318,430 B2
`Page 2
`
`u.s. PATENT DOCUMENTS
`201110105353 Al
`5/2011 Lo et al.
`201110117548 Al
`5/2011 Mitchelletal.
`201110177517 Al
`7/2011 Ravaetal.
`201110201507 Al
`8/2011 Rava et al.
`201110224087 Al
`9/2011 Quake et al.
`201110230358 Al
`9/2011 Rava
`201110245085 Al
`10/2011 Rava et al.
`201110312503 Al
`12/2011 Chuuetal.
`2012/0010085 Al
`112012 Rava et al.
`2012/0034603 Al
`2/2012 Oliphant et al.
`2012/0034685 Al
`2/2012 Sparks et al.
`
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`WO
`
`FOREIGN PATENT DOCUMENTS
`WO 98/44151 Al
`10/1998
`WO 00/18957 Al
`4/2000
`WO 03/020974 A2
`3/2003
`9/2003
`WO 03/020974 A3
`WO 2004/065629 Al
`8/2004
`12/2005
`WO 2005/118852 A2
`2/2006
`WO 2006/010610 A2
`WO 2005/118852 A3
`3/2006
`6/2006
`WO 2006/010610 A3
`9/2006
`WO 2006/097049 Al
`WO 2007/044091 A2
`4/2007
`7/2007
`WO 2007/075836 A2
`8/2007
`WO 2007/092473 A2
`WO 2007/100911 A2
`9/2007
`WO 2007/044091 A3
`1112007
`WO 2007/100911 A3
`1112007
`WO 2007/132166 A2
`11/2007
`WO 2007/132167 A2
`1112007
`WO 2007/147073 A2
`12/2007
`12/2007
`WO 2007/147074 A2
`12/2007
`WO 2007/147076 A2
`12/2007
`WO 2007/147079 A2
`2/2008
`WO 2007/075836 A3
`2/2008
`WO 2007/132166 A3
`3/2008
`WO 2007/147079 A3
`4/2008
`WO 2007/147076 A3
`4/2008
`WO 2008/045158 Al
`5/2008
`WO 2007/132167 A3
`5/2008
`WO 2007/147073 A3
`5/2008
`WO 2007/147074 A3
`11/2008
`WO 2007/092473 A3
`WO 2009/013492 Al
`112009
`WO 2009/013496 Al
`112009
`WO 2009/019455 A2
`2/2009
`WO 2009/019455 A3
`4/2009
`WO 2010/033578 A2
`3/2010
`4/2010
`WO 2010/045617 A2
`WO 2010/033578 A3
`5/2010
`WO 2010/085815 Al
`7/2010
`2/2011
`WO 20111014741 Al
`WO 20111051283 Al
`5/2011
`7/2011
`WO 20111090556 Al
`7/2011
`WO 20111090557 Al
`7/2011
`WO 20111090558 Al
`7/2011
`WO 20111090559 Al
`7/2011
`WO 20111091046 Al
`7/2011
`WO 20111091063 Al
`8/2011
`WO 20111094646 Al
`8/2011
`WO 20111102998 A2
`2/2012
`WO 2012/019187 A2
`2/2012
`WO 2012/019193 A2
`2/2012
`WO 2012/019198 A2
`2/2012
`WO 2012/019200 A2
`
`OTHER PUBLICATIONS
`
`Fan et al. Noninvasive diagnosis of fetal aneuploidy by shotgun
`sequencing DNA from maternal blood. Oct. 21, 2008. Proceedings of
`the National Academy of Sciences. pp. 16266-16271.*
`U.S. Appl. No. 13/191,366, filed Jul. 26, 2011, Rava et al.
`U.S. Appl. No. 13/364,809, filed Feb. 2, 2012, Rava et al.
`U.S. Appl. No. 13/365,134, filed Feb. 2, 2012, Rava et al.
`Bennett, et al. Toward the 1,000 dollars human genome.
`Pharmacogenomics. 2005; 6(4):373-82.
`
`Fan, et al. Highly parallel genomic assays. Nat Rev Genet. Aug.
`2006;7(8):632-44.
`Margulies, et al. Genome sequencing in microfabricated high-den(cid:173)
`sity picolitre reactors. Nature. 2005; 437:376-80.
`Shendure, et al. Next-generation DNA sequencing: Nature. 2008;
`26(10): 1135-1145.
`Yang, et al. Rapid Prenatal Diagnosis of Trisomy 21 by Real-time
`Quantitative Polymerase Chain Reaction with Amplification of
`Small Tandem Repeats and S100B in Chromosome 21.Yonsei Medi(cid:173)
`cal Journal, 2005, vol. 46, No.2, 193-197.
`Bentley, et al. Accurate whole human genome sequencing using
`reversible terminator chemistry. Nature. Nov. 6, 2008;456(7218):53(cid:173)
`9.
`Botezatu, et al. Genetic analysis of DNA excreted in urine: a new
`approach for detecting specific genomic DNA sequences from cells
`dying in an organism. Clin Chern. Aug. 2000;46(8 Pt 1):1078-84.
`Butler, et al. The development ofreduced size STRarnplicons as tools
`for analysis ofdegraded DNA. J Forensic Sci. Sep. 2003;48(5): 1054(cid:173)
`64.
`Butler. Short tandem repeat typing technologies used in human iden(cid:173)
`tity testing. Biotechniques. Oct. 2007;43(4):ii-v.
`Chan, et al. Size distributions ofmaternal and fetal DNA in maternal
`plasma. Clin Chern. Jan. 2004;50(1):88-92.
`Chen, et al. Microsatellite alterations in plasma DNA of small cell
`lung cancer patients. Nat Med. Sep. 1996;2(9):1033-5.
`Chiu, et al. Maternal plasma DNA analysis with massively parallel
`sequencing by ligation for noninvasive prenatal diagnosis oftrisomy
`21. ClinChem. Mar. 2010;56(3):459-63.
`Chiu, et al. Non-invasive prenatal assessment of trisomy 21 by mul(cid:173)
`tiplexedmaternal plasma DNA sequencing: large scale validity study.
`BMJ. Jan. 11, 2011;342:c7401.
`Chiu, et al. Non-invasive prenatal diagnosis by single molecule
`counting technologies. Trends Genet. Jul. 2009;25(7):324-31.
`Chiu, et al. Noninvasive prenatal diagnosis of fetal chromosomal
`aneuploidy by massively parallel genomic sequencing of DNA in
`maternal plasma. Proc Natl Acad Sci USA. Dec. 23,
`2008; 105(51):20458-63.
`Chu, et al. Statistical model for whole genome sequencing and its
`application to minimally invasive diagnosis of fetal genetic disease.
`Bioinformatics. May 15, 2009;25(10):1244-50.
`Coble, et al. Characterization ofnew miniSTR loci to aid analysis of
`degraded DNA. J Forensic Sci. Jan. 2005;50(1):43-53.
`Dhallan, et al. A non-invasive test for prenatal diagnosis based on
`fetal DNA present in maternal blood: a preliminary study. Lancet.
`Feb. 10,2007;369(9560):474-81.
`Dixon, et al. Analysis of artificially degraded DNA using STRs and
`SNPs-results of a collaborative European (EDNAP) exercise.
`Forensic Sci Int. Dec. 1,2006;164(1):33-44.
`Ehrich, et al. Noninvasive detection offetal trisomy 21 by sequencing
`of DNA in maternal blood: a study in a clinical setting. Am J Obstet
`Gynecol. Mar. 2011;204(3):205.el-l1.
`Fan, et al. Analysis of the size distributions of fetal and maternal
`cell-free DNA by paired-end sequencing. Clin Chern. Aug.
`2010;56(8): 1279-86.
`Fan, et al. Detection of aneuploidy with digital polymerase chain
`reaction. Anal Chern. Oct. 1,2007;79(19):7576-9.
`Fan, et al. In principle method for noninvasive determination of the
`fetal genome. Nature Precedings: Nature Precedings 10.1038/npre.
`2010.5373.1 .2010.
`Fan, et al. Microfluidic digital PCR enables rapid prenatal diagnosis
`offetal aneuploidy. Am J Obstet Gynecol. May 2009;200(5):543.el(cid:173)
`7.
`Fan, et al. Noninvasive diagnosis of fetal aneuploidy by shotgun
`sequencing DNA from maternal blood. Proc Natl Acad Sci USA.
`Oct. 21, 2008;105(42):16266-71.
`Fan, et al. Sensitivity of noninvasive prenatal detection of fetal
`aneuploidy from maternal plasma using shotgun sequencing is lim(cid:173)
`ited only by counting statistics. PLoS One. May3, 20 1O;5(5):eI0439.
`Fan, et al. Whole Genome Molecular Haplotyping of Single Cells.
`Nat Biotechnol. Jan. 2011;29(1):51-7.
`Ghanta, et al. Non-invasive prenatal detection of trisomy 21 using
`tandem single nucleotide polymorphisms. PLoS One. Oct. 8,
`2010;5(10):eI3184.
`
`Ariosa Exhibit 1001, p. 2
`
`

`

`US 8,318,430 B2
`Page 3
`
`Grubweiser, et al. A new miniSTR-mulitplex displaying reduced
`amplicon lengths for the analysis ofdegraded DNA. Int J Legal Med.
`Mar. 2006;120(2):115-20.
`Hanson, et al. Whole genome amplification strategy for forensic
`genetic analysis using single or few cell equivalents of genomic
`DNA. Anal Biochem. Nov. 15,2005;346(2):246-57.
`Harris, et al. Single-molecule DNA sequencing of a viral genome.
`Science. Apr. 4, 2008;320(5872): 106-9.
`Harrison, et al. Polymer-stimulated ligation: enhanced ligation of
`oligo- and polynucleotides by T4 RNA ligase in polymer solutions.
`Nucleic Acids Res. Nov. 12, 1984;12(21):8235-51.
`Hayashi, et al. Regulation of inter- and intramolecular ligation with
`T4 DNA ligase in the presence ofpolyethylene glycol. Nucleic Acids
`Res. Oct. 10, 1986;14(19):761731.
`Hill, et al. "Characterization of 26 new miniSTR loci" Poster #44(cid:173)
`17th International Symposium on Human Identification, Nashville,
`TN, Oct. 10-12,2006.
`Huang, et al. Isolation of cell-free DNA from maternal plasma using
`manual and automated systems. Methods Mol BioI. 2008;444:203-8.
`Hung, et al. Detection of circulating fetal nucleic acids: a review of
`methods and applications. J Clin Pathol. Apr. 2009;62(4):308-13.
`Illumina. Preparing samples for CHIP sequencing of DNA. Epub at
`gref.jhmi.edulhts/protocols/11257047_ChIP_Sample_Prep.pdf.
`2007.
`International search report and written opinion dated Feb. 28, 2011
`for PCT Application No. US 10/58606.
`International search report and written opinion dated Mar. 1, 2011 for
`PCT Application No. USlO/58614.
`International search report and written opinion dated Apr. 4, 2011 for
`PCT Application No. US 10/58609.
`International search report and written opinion dated Apr. 11, 2011
`for PCT Application No. US 11/21729.
`International search report dated May 19, 2011 for PCTIUS2010/
`058612.
`International. The International HapMap Project. Nature. 2003;
`426:789-96.
`Jama, etal. Quantification ofCell-Free Fetal DNA Levels in Maternal
`Plasma by STRAnalysis. ACMG Annual Clinical Genetics Meeting
`Poster 398; Mar. 24-28, 2010. Available online at http://acmg.
`omnibooksonline.com/2010/data/papers/398.pdf and http://acmg.
`omnibooksonline.com/201O/index.htrnl.
`Jorgez, et al. Improving enrichment of circulating fetal DNA for
`genetic testing: size fractionation followed by whole gene amplifi(cid:173)
`cation. Fetal Diagn Ther. 2009;25(3):314-9.
`Ju, et al. Four-color DNA sequencing by synthesis using cleavable
`fluorescent nucleotide reversible terminators. Proc Nat! Acad Sci
`USA. 2006; 103(52):19635-19640.
`Kidd, et al. Developing a SNP panel for forensic identification of
`individuals. Forensic Sci Int. Dec. 1,2006;164(1):20-32.
`Koide, et al. Fragmentation of cell-free fetal DNA in plasma and
`urine of pregnant women. Prenat Diagn. Jul. 2005;25(7):604-7.
`Kozarewa, et al. Amplification-free Illumina sequencing-library
`preparation facilitates improved mapping and assembly of GC-bi(cid:173)
`ased genomes. Nat Methods. Apr. 2009;6(4):291-5.
`Lazinski, et al. Modified protocol for Illumina paired-end library
`construction. Available online at http://genomics.med.tufts.edu/
`documents/htseq_protocol_for_illumina_paired.pdf
`Accessed
`Jun. 21, 2011.
`Leon, et al. Free DNA in the serum of cancer patients and the effect
`of therapy. Cancer Res. Mar. 1977;37(3):646-50.
`Levy, et al. The Diploid Genome Sequence of an Individual Human.
`PLoS BioI. 2007 Sep 4;5(10):e254.
`Li, et al. Size separation of circulatory DNA in maternal plasma
`permits ready detection of fetal DNA polymorphisms. Clin Chern.
`Jun. 2004;50(6):1002-11.
`Liao, et al. Targeted massively parallel sequencing of maternal
`plasma DNA permits efficient and unbiased detection offetal alleles.
`Clin Chern. Jan. 2011;57(1):92-101.
`Liu, et al. Feasibility study ofusing fetal DNA in maternal plasma for
`non-invasive prenatal diagnosis. Acta Obstet Gynecol Scand.
`2007;86(5):535-41.
`
`Lo, et al. Digital PCR for the molecular detection of fetal chromo(cid:173)
`aneuploidy. Proc Nat! Acad Sci USA. Aug. 7,
`somal
`2007; 104(32): 13116-21.
`Lo, et al. Increased fetal DNA concentrations in the plasma ofpreg(cid:173)
`nant women carrying fetuses with trisomy 21. Clin Chern. Oct.
`1999;45(10): 1747-51.
`Lo, et al. Maternal plasma DNA sequencing reveals the genome-wide
`genetic and mutational profile of the fetus. Sci Transl Med. Dec. 8,
`2010;2(61 ):61ra91.
`Lo, etal. Presence offetal DNA in maternal plasma .Lancet.Aug. 16,
`1997;350(9076):485-7.
`Lo, et al. Quantitative analysis offetal DNA in maternal plasma and
`serum: implications for noninvasive prenatal diagnosis. Am J Hum
`Genet. Apr. 1998;62(4):768-75.
`Lo, et al. Rapid clearance of fetal DNA from maternal plasma. Am J
`Hum Genet. Jan. 1999;64(1 ):218-24.
`Lo, Y. M. Noninvasive prenatal detection of fetal chromosomal
`aneuploidies by maternal plasma nucleic acid analysis: a review of
`the current state of the art. BJOG, 2009, vol. 116, 152-157.
`Lun, et al. Microfluidics Digital PCR Reveals a Higher than Expected
`Fraction ofFetal DNA in Maternal Plasma. Clinical Chemistry, 2008,
`vol. 54, No. 10, 1664-1672.
`McKernan, et al. Sequence and structural variation in a human
`ligation
`genome uncovered by short-read, massively parallel
`sequencing
`using
`two-base
`encoding. Genome Res.
`Sep.
`2009; 19(9): 1527-41.
`Metzker. Sequencing technologies-the next generation. Nat Rev
`Genet. Jan. 2010;11(1):31-46.
`Nakamoto, et al. Detection of microsatellite alterations in plasma
`DNA of malignant mucosal melanoma using whole genome ampli(cid:173)
`fication. Bull Tokyo Dent Coli. May 2008;49(2):77-87.
`Nicklas, et al. A real-time multiplex SNP melting assay to discrimi(cid:173)
`nate individuals. J Forensic Sci. Nov. 2008;53(6): 1316-24.
`Pakstis, et al. Candidate SNPs for a universal individual identification
`panel. Hum Genet. May 2007; 121(3-4):305-17.
`Pakstis, et al. SNPs for a universal individual identification panel.
`Hum Genet. Mar. 2010;127(3):315-24.
`Pathak, et al. Circulating cell-free DNA in plasma/serum of lung
`cancer patients as a potential screening and prognostic tool. Clin
`Chern. Oct. 2006;52(10):1833-42.
`Pertl, et al. Detection ofmale and female DNA in maternal plasma by
`multiplex fluorescent polymerase chain reaction amplification of
`short tandem repeats. Hum Genet. Jan. 2000;106(1):45-9.
`Pheiffer, et al. Polymer-stimulated ligation: enhanced blunt- or cohe(cid:173)
`sive-end ligation of DNA or deoxyribooligonucleotides by T4 DNA
`solutions. Nucleic Acids Res. Nov. 25,
`ligase in polymer
`1983; 11(22):7853-71.
`Pushkarev, et al. Single-molecule sequencing ofan individual human
`genome. Nat Biotechnol. Sep. 2009;27(9):847-50.
`Quail, et al. A large genome center's improvements to the Illumina
`sequencing system. Nat Methods. Dec. 2008;5(12): 1005-10.
`Schwartzenbach, et al. Cell-free tumor DNA in blood plasma as a
`marker for circulating tumor cells in prostate cancer. Clin Cancer
`Res. Feb. 1,2009;15(3):1032-8.
`Schwartzenbach, et al. Comparative evaluation of cell-free tumor
`DNA in blood and disseminated tumor cells in bone marrow of
`patients with primary breast
`cancer. Breast Cancer Res.
`2009; 11 (5):R71.
`Su, et al. Human urine contains small, 150 to 250 nucleotide-sized,
`soluble DNA derived from the circulation and may be useful in the
`detection of colorectal cancer. J Mol Diagn. May 2004;6(2): 101-7.
`Tong, et al. Noninvasive prenatal detection of trisomy 21 by an
`epigenetic-genetic chromosome-dosage approach. Clin Chern. Jan.
`2010;56(1):90-8.
`Vallone, et al. Demonstration of rapid multiplex PCR amplification
`involving 16 genetic loci. Forensic Sci Int Genet. Dec. 2008;3(1):42(cid:173)
`5.
`Voelkerding, et al. Digital Fetal Aneuploidy Diagnosis by Next(cid:173)
`Generation Sequencing. Clin Chern. Mar. 2010;56(3):336-8.
`Voelkerding, et al. Next-generation sequencing: from basic research
`to diagnostics Clin Chern. Apr. 2009;55(4):641-58.
`Wheeler, et al. The complete genome of an individual by massively
`parallel DNA sequencing. Nature. Apr. 17,2008;452(7189):872-6.
`
`Ariosa Exhibit 1001, p. 3
`
`

`

`US 8,318,430 B2
`Page 4
`
`Wright, etal. The use ofcell-free fetal nucleic acids in maternal blood
`for non-invasive prenatal diagnosis. Hum Reprod Update. Jan.-Feb.
`2009;15(1): 139-51.
`Zimmerman, et al. Macromolecular crowding allows blunt-end liga(cid:173)
`tion by DNA ligase from rat liver ofEscheridia coli. Proc Nat! Acad
`Sci USA. Oct. 1983;80(19):5852-6.
`U.S. Appl. No. 13/333,832, filed Dec. 21, 2011, Rava et al.
`U.S. Appl. No. 13/365,240, filed Feb. 2, 2012, Quake et al.
`U.S. Appl. No. 13/433,232, filed Mar. 28, 2012, Stoughton et al.
`European Patent Office Communication dated Mar. 16,2012 in EP
`App. No. 10830938.6 (EP Publication No. 2366031) with pending
`claims, 9 pages.
`European Patent Office Communication dated Mar. 16,2012 in EP
`App. No. 10830939.4 (EP Publication No. 2376661) with pending
`claims, 9 pages.
`European Patent Office Communication dated Mar. 19,2012 in EP
`App. No. 10825822.9 (EP Publication No. 2370599) with pending
`claims, 10 pages.
`
`European Supplementary Search Report for EP App. No. 10830938.6
`(EP Publication No. 2366031), dated Feb. 22, 2012, 4 pages.
`European Supplementary Search Reportfor EP App. No.1 0825822.9
`(EP Publication No. 2370599), dated Feb. 22, 2012,4 pages.
`European Supplementary Search Report for EP App. No.1 0830939.4
`(EP Publication No. 2376661), dated Feb. 22, 2012, 4 pages.
`Lo, et al. Non-invasive prenatal diagnosis of fetal chromosomal
`aneuploidies by maternal plasma nucleic acid analysis. Clinical
`Chemistry. 2008; 54 (3):461-466.
`U.S. Appl. No. 13/452,083, filed Apr. 20, 2012, Fan et al.
`Notice of allowance dated Jul. 12, 2012 for U.S. Appl. No.
`13/452,083.
`Office action dated Jun. 5, 2012 for U.S. Appl. No. 12/393,833.
`
`* cited by examiner
`
`Ariosa Exhibit 1001, p. 4
`
`

`

`PCR/ProbeAnalysis
`BioJuudyzerAnalysis
`
`......PCRfragment-.200bp
`
`...Ch21~Specifje
`
`......IntergerdeDNA
`
`Figure1
`
`110
`
`108
`
`106
`
`104
`
`102
`
`100
`
`Ariosa Exhibit 1001, p. 5
`
`

`

`150__.R
`
`~
`
`150F
`
`':..:-MOo1
`
`00R •
`
`~2
`
`200F
`
`.•••••~.i~
`
`1peRsingle'primerpair-(1,2t3,~t5~6,~andlJ
`
`PCRtl1tdtip~ex
`
`Universaltherm:0cycleprogram
`
`Targ:etC,ell...FreeDNAChromosome21HotSpot
`
`Figure2
`
`Ariosa Exhibit 1001, p. 6
`
`

`

`Conc.ng:lui
`NO:NotOE'tedable
`
`"i:l;~Data
`
`4$9
`
`4.01.
`
`4,71
`
`2Jra
`
`SJ~l
`
`S.15
`
`2~'l7
`
`'1150
`
`9.U1
`
`au
`
`IIJ~t
`
`~.4-6
`
`5,19
`
`3/14-
`
`N·o-Dma
`
`l:OJ11
`
`10,24
`
`4~S~
`
`Nt)Data
`
`$.U~
`
`$;$$
`
`1.ttl
`
`2___150
`
`4.1.
`
`:9.4-
`
`~,gl
`
`~,~9
`
`3.tla
`
`4.JU
`
`5·yl.5il1
`
`6.S
`
`1.91
`
`9S1
`
`~.41
`
`~:"lSQ
`
`ltl,lZ
`
`11..1g·
`
`Ull1
`
`1,1$·
`
`NoO~ta
`
`g,Ss
`
`·'1.'1a
`
`14,:33
`
`4....150
`
`,-,:.,.,.,-,:.,-,:.,-,:.,-,:.,-,:.,-,:.,-,:.,-,:.,-,:.,.,...,-,:.,-,:.,-,:.,-,:.,-,:.,-,:.,-,:.,-,:.,.,.,-,:.,-,:.,.,.,-,:.,-,:.,-,:.,-,:.,-,:.,-,:.,-,:.,-,:.,-,:.,.,.,-,:.,
`
`22,9'1
`
`II,S:S
`
`,-,:.,.,.,-,:.,-,:.,-,:.,-,:.,-,:.,-,:.,-,:.,-,:.,-,:.,.,.,
`
`HL3'9
`
`,-,:.,.,.,-,:.,-,:.,.,.,-,:.,-,:.,-,:.,-,:.,-,:.,-,:.,-,:.,
`
`13,43
`
`,-,:.,-,:.,-,:.,-,:.,.,.,-,:.,-,:.,-,:.,-,:.,-,:.,-,:.,-,:.,
`
`9,.11
`
`,-,:.,-,:.,-,:.,-,:.,-,:.,-,:.,-,:.,-,:.,-,:.,-,:.,-,:.,.,..,-,:.,-,:.,-,:.,-,:.,-,:.,-,:.,-,:.,-,:.,.,.,-,:.,-,:.,.,.,-,:.,-,:.,-,:.,-,:.,
`
`Nt)D~ta
`
`1!t:3:2
`
`,-,:.,-,:.,-,:.,-,:.,-,:.,-,:.,-,:.,-,:.,-,:.,-,:.,-,:.,.,.,
`
`'9.34
`
`.,~.,~.'"'.,~:~.,~.,-':.,~.,-':.,-':.,-':.'"'.,,-,:.,.,.,-,:.,-,:.,-,:.,-,:.,-,:.,-,:.,-,:.,-,:.,-,:.,.,.,
`
`15$3
`
`31.00
`
`-,...----i'--..;.;;..;;.==;..;;;...;..;.;..;;.--I
`
`Q~~~mkONA
`
`...........................+-----,r-----~---__r-.;;.;;.;....;;;..;...;;..;;;;.;:.;.;;..;;r;..;;;...;;..;;;..;.-_,_---_r__--
`
`10dP:~~maPNA
`
`Figure3
`
`Ariosa Exhibit 1001, p. 7
`
`

`

`U.S. Patent
`
`Nov. 27, 2012
`
`Sheet 4 0f 28
`
`US 8,318,430 B2
`
`
`
`
`
`mammmmfimm‘__
`
`
`
`@828,“.mmgm.nw@5me
`
`w...,
`
`mmmwmmWham
`
`Figure4
`
`m$23.3..,_w3wavg..w3Nmmwwm%whwmmmnw
`
`wmammmE”
`
`E .
`
`mmwWm
`
`was.$me
`
`mg%m
`
`wma
`
`.W.
`
`Ariosa Exhibit 1001, p. 8
`
`
`

`

`U.S. Patent
`
`Nov. 27, 2012
`
`Sheet 5 0f 28
`
`US 8,318,430 B2
`
`11.12
`
`11.72
`
`lCL12
`
`lLt}g:
`
`1.150
`
`1.....lSU
`
`«@2me
`
`Wm“mmmmug
`
`wwmmmwxwgnu m.
`
`1150
`
`5.....150
`
`1
`
`1 1
`
`2
`
`Ariosa Exhibit 1001, p. 9
`
`

`

`U.S. Patent
`
`Nov. 27, 2012
`
`Sheet 6 0f 28
`
`US 8,318,430 B2
`
`F'igure6
`
`.$3.3
`
`
`
`3.”ram”WEE_22mm..m
`
`r.
`v
`
`.ww,QM
`
`wag“ami wm4w.
`
`
`
`mm”_Wm.M,waxmm3m
`
`.wu
`
`mummy.w
`
`
`
`MwwwawwMum
`
`
`
`W.aflmwmw,“fiawmww‘
`
`““wammfig,.
`
`$3me
`
`Ariosa Exhibit 1001, p. 10
`
`
`

`

`198nM
`
`.240nM
`
`r/J>
`241167uL1_1:00_60
`
`Figure7
`
`Ariosa Exhibit 1001, p. 11
`
`

`

`sx~>.;tr{
`&~$.~-::{~::.
`
`H
`
`44x:>xWi"
`
`~;):5);'~n::;
`'~~"f.5.>.:.::({~
`
`H_)lj:<::>x:ll:i"
`
`6A
`
`~;4."(5KH)~
`'!00>;$>;-H}~
`
`'lH;:<~KK?
`4f-:;3;~:>",-~~/
`
`{l
`
`d\-lilPGR(;,:)'..::>'>.t$
`
`FigureS
`
`S~4-i:it;"p(~:Rt:-r5f~~;:--:::~H::::·~t
`
`24n-!;.jp;;:;!~m,;()N!\
`
`CtjL't"J
`ehl
`'1:
`
`.~
`
`C~~;~~~;;a~·~
`·Chi:....::
`
`241:'!'1:;P<.::H;E>'>.riB'hm®l
`
`.;=
`
`·Cts"t
`
`14n-!~<:fp;,:wm",()~¥A
`
`f2!,C;~;;;l&rgtH"lA
`Cll£1(;'Cirl"
`
`CtjL'(~:}
`i5dt
`
`12'lC<~lkll,,-,{~~DNApeR
`
`f:j-::~);~~~:~~'l-::~~~:.
`
`ON/~
`
`T~'~C"~:~iJ~»:
`
`t~h·t..t
`
`24t·~·~~<iph::-!$m~:'l~~~A
`
`::;;'Cirl
`
`Gll;''',:
`
`Ch:~~·lS
`Ch-i:
`"t
`
`Ct~~?t~..f3
`-t
`t~~,::·t
`
`24':!1:;P(::!~;E>'>.6B'hm®l
`
`24f1~~:~£jf;k17$frt~~"~r:~r~~A
`
`·C~:-:2::..:2lC~'~
`
`U,1!2
`t:;h-i:....."t
`
`Ch11,2
`-Ct':d:
`-.;=
`
`24t1~;:PCH!::n,><~h';,H:",,1
`
`14t~·~~:-::1p::wm:3::)NA
`
`-Ch2\...1~({~~h'~.....
`
`C~~~(...1:
`
`Ch:::-j"-1:
`1:
`<::h1:
`
`A
`
`Ariosa Exhibit 1001, p. 12
`
`

`

`:::Ch21_5~FAM
`,*Ch'1"YIC
`
`.
`
`.
`
`~:.::::.::'::::S'
`
`~..::.,.,
`
`,;..:;;::;:.
`
`Ch.ii,J~AM
`eMVtC
`
`l':l
`Ml
`Nti
`i$)
`~~w..::
`2St}.{
`,){Jtl
`..;:
`:ibD.:
`
`,"12);765dPCR
`
`IpeR
`
`CfONA
`
`Figure8cont.
`
`~.
`Chi11Ch2i1
`Ch1~1fCh21~5
`Ch'C1!C1121_2
`Ch1_1fCh21_1
`my!Wl!f;}t
`
`-
`
`Ch2:11
`Ch21......5
`Ch2:1....;2
`Ch21_1
`Chi
`
`t
`
`:!Sl~!f;pl~~
`
`B
`
`c
`
`Ariosa Exhibit 1001, p. 13
`
`

`

`1.6nM
`
`1.1oM
`
`1.1nM
`
`Figure9
`
`Ariosa Exhibit 1001, p. 14
`
`

`

`5...150.....'lOJ725'S5...r
`
`Figure10
`
`Ariosa Exhibit 1001, p. 15
`
`

`

`SynthesizedandArrangediR96wellPlate
`
`l
`
`Selec:tPrimersFromClustersIRegion
`
`ParametersSettoUniversalThermoCycleProgram
`
`140",150bppeRFragment
`
`UniqueonCh2:1!
`
`.
`
`!i
`
`r""""''''''''''''''''''''''''''D;';i;~''1;'O';'CR'';';;';;;;''''''''''''""""''''''''''''''''''''''''''''''''''1
`~l
`
`PRIMER*BLASTI
`
`Ii
`
`Downsyndromecriticalregion(DSCR)5.8Mbp
`
`1FASTASeq
`
`Figure11
`
`1108
`
`1106
`
`1102
`
`Ariosa Exhibit 1001, p. 16
`
`

`

`55J)O%
`
`59,16
`
`225328~1522632834
`
`GC%
`
`Tin
`
`140
`
`Producthmgth
`
`20
`
`20
`
`Minus
`
`TCCAGGCTGTGTGCCCTCCC
`
`Plus
`
`TG1~GCCCGGGAGGTTCCCT
`
`Forward
`
`Strandon
`
`.<._"
`
`4c.
`
`Primerpair18
`
`Figure12
`
`Ariosa Exhibit 1001, p. 17
`
`

`

`~EL'",,;;,"'""""''"'''"'''':'':::':'::,'::'::::::;:;;;:::;;_'1
`1[11::,;-;:1id'Jatr.u&tts·
`.·.K«fse·.,.,.•••Mjrl·ttltnttnilJoltmUmd"~
`Ii'•.....,•.....,•.....,,•.....,••......::.
`If~::;;';r
`
`i'i
`
`:
`
`i
`
`,
`
`}:~
`
`~;i::
`
`~
`
`:
`
`osCriticalRegl(lfl
`3;5AU.l2~OOO..41~120~OOOii.·,·,·,·,·,·,·,·,·,·,·,·,·,·,·,·,·'''·,·'''·'''''''''''"''''
`
`'V
`
`.
`
`~
`
`-*E-:
`501{
`
`·········A··ii········································
`
`):
`50K'IooK
`
`Figure13
`
`Ariosa Exhibit 1001, p. 18
`
`

`

`U.S. Patent
`
`Nov. 27, 2012
`
`Sheet 15 0f28
`
`US 8,318,430 B2
`
`
`
`Figure14
`
`Ariosa Exhibit 1001, p. 19
`
`

`

`Coru:.ngIut
`
`NO:NotOe:tectable
`
`----------------,--------1-------------------------.---------------------------------------------------
`
`1.83
`11.00
`
`tk&
`6.98
`
`I4,616.<U6.69
`1,216.21
`
`4,91
`
`11.14
`
`t19
`
`R~i¢t),c~actU$.i:~fSf
`
`.
`
`.t·
`
`.
`
`,(19$.1,4,
`
`.
`
`16.40
`25-.14
`
`4.8
`13:,14
`
`SAl
`itt0e6
`
`10.91
`1.M
`15.:116.12
`
`,
`
`1.9~
`
`:2S9
`
`11.29
`1,9
`
`).,<U
`
`N-oOata
`
`5,81
`$,59
`
`2S1
`V)1
`
`I
`
`8.S1
`..................................................+
`12:,36,
`
`en
`t55
`
`<tJ1
`3J~1
`
`a1
`S16
`
`R~fQn6t&CiY$t:~~)
`
`---------------------------------------------------+---------------------------------------------------------------------------------------------------------------------------------------------------------
`
`1(k87
`NO
`
`11,39
`NO
`
`1$,l'
`NO
`
`6,02
`ND
`
`I
`
`1.$,1$
`NO,
`
`aM
`IUS
`
`25-,21
`NO
`
`---------------------------------------------------+---------------------------------------------------------------------------------------------------------------------------------------------------------
`
`NO
`NO
`
`NO
`NO
`
`NO
`NO
`
`Nt)
`NO
`
`NO
`NO
`
`Ala
`A2
`
`Nt~
`ND
`
`I
`i
`
`24102
`
`Figure15
`
`Ariosa Exhibit 1001, p. 20
`
`

`

`U.S. Patent
`
`Nov. 27, 2012
`
`Sheet 17 0f28
`
`US 8,318,430 B2
`
`Figure16
`
`
`
`{magma
`
`L}
`
`
`
`‘4?1"“
`m
`w
`13.. N
`$2
`
`”a
`
` mm 4
`
`::
`1:»;
`an
`
`Ariosa Exhibit 1001, p. 21
`
`

`

`3.24
`
`6•.98
`
`9.94
`
`15.15
`
`Conc,.ng!ul
`
`(h2l100
`
`Ch2..1v1S0
`
`24101
`
`1.120$
`
`1121$
`
`Figure17
`
`Ariosa Exhibit 1001, p. 22
`
`

`

`('111)
`
`100%Ampl:ificati!·an
`
`(16/21)
`
`76%Amplification
`
`Chro:mosomeWalk
`
`Figure18
`
`Ariosa Exhibit 1001, p. 23
`
`

`

`46927127
`4000tl015
`29999849
`
`10000038
`
`End
`
`Start
`
`$orted4
`
`Sorted2
`Sorted1.
`S·ortedO
`
`i~Qg1'"jg,..
`::::.:.:-:.:.:-:-:-:-:.:.:.:-:-:.:-:.:.:-:-:.::::
`
`CQv~fage=O.1x
`
`3tlGOMbas:&iGeno;m~
`10MreadsJlaneX36bal~eIread#300:Mbase
`Individual1lane
`
`790/0ofCh21
`Cover31Mbregions.
`
`CombineSequenceRuns
`
`Chromosome21-47Mb
`
`Figure19
`
`Ariosa Exhibit 1001, p. 24
`
`

`

`~-N.
`
`....
`.....
`r:.Fi=-~
`
`O
`NQ
`0.
`
`.....
`
`
`
`N0.N
`
`:2
`
`0~ N
`
`~......:J
`
`U.S. Patent
`
`Nov. 27, 2012
`
`.:
`Sheet 21 0f28
`
`US 8,318,430 B2
`
`.
`
`r;~··············
`
`I:
`
`.~
`
`'
`
`i.
`
`:
`
`
`
`
` Ch2’3 1«46,244,322
`
`:N
`Figure20
`
`~-.i
`~,....,:
`~~I
`··········j..·;;··i
`
`'~f%:
`
`'Co:::.,....•..,..,.,.,.,..,.,
`
` ," 127321313:
`g» 13131513312:
`
`, :efifirg, I};
`
`
`
`~ 213mm
`
`341 ~37;
`
`Ch21
`
`Ariosa Exhibit 1001, p. 25
`
`

`

`u.s. Patent
`
`Nov. 27, 2012
`
`Sheet 22 of 28
`
`US 8,318,430 B2
`
`'f""
`
`N4
`
`>....
`•:i
`t'D
`lC'~LL
`
`Ariosa Exhibit 1001, p. 26
`
`

`

`Figure22A
`
`13,296,000-46,944,323
`
`33,648,324bp
`
`Ariosa Exhibit 1001, p. 27
`
`

`

`U.S. Patent
`
`Nov. 27, 2012
`
`Sheet 24 0f28
`
`US 8,318,430 B2
`
`
`
`Figure22B
`
`Ariosa Exhibit 1001, p. 28
`
`

`

`.
`
`..
`
`.............................................
`
`Figure23
`
`i::~ltullilJ~~~,~
`
`!'Mf······:·············"N·I··~·······
`
`.;:...;:
`
`:;;.
`
`Ariosa Exhibit 1001, p. 29
`
`

`

`AAr:J,N3CCG~CCCCCM.GAGGTGCf1G
`>dn21:45651006-45651005•{2fibaoSe}
`
`45~651~549..45..655...755
`
`f4207bp)
`
`Figure24
`
`Ariosa Exhibit 1001, p. 30
`
`

`

`:::::*f~:~;:::·:~<~~~~~~~~.
`
`i~f<~:S:·:·tilllt)
`
`45,651,908.-.45,652,158
`
`f251bp)
`
`Figure.25
`
`Ariosa Exhibit 1001, p. 31
`
`

`

`Primsr2
`(N)40
`
`Prioleri_Index
`
`Primer2
`
`Primer1»Jndex
`
`PCRPrhner2
`
`IUumina
`
`peRPrimar1:
`
`Ulumina
`
`c
`
`~""'"
`:::::">:.::a
`
`~:.
`
`.:
`
`Tr""'"
`
`n~~_'
`
`·t<:~~
`
`Figure26
`
`3rdPCR
`
`.........
`
`Eor"i:ebadLib
`
`.•.,',."..,..:.
`
`A
`
`Ariosa Exhibit 1001, p. 32
`
`

`

`US 8,318,430 B2
`
`1
`METHODS OF FETAL ABNORMALITY
`DETECTION
`
`CROSS-REFERENCE
`
`This application is a continuation of U.S. patent applica(cid:173)
`tionSer. No. 13/012,222, filed Jan. 24, 2011, which claims the
`benefit ofU.S. Provisional Application No. 61/297,755, filed
`Jan. 23, 2010, each of which application is incorporated
`herein by reference in its entirety.
`
`SEQUENCE LISTING
`
`The instant application contains a Sequence Listing which
`has been submitted in ASCII format via EFS-Web and is
`hereby incorporated by reference in its entirety. Said ASCII
`copy, created on Jan. 25, 2012, is named 32477692.txt and is
`27,793 bytes in size.
`
`BACKGROUND OF THE INVENTION
`
`Massively parallel sequencing techniques are used for
`detection of fetal aneuploidy from samples that comprise
`fetal and maternal nucleic acids. Fetal DNA often constitutes
`less than 10% of the total DNA in a sample, for example, a
`maternal cell-free plasma sample. Sequencing a large number
`of polynucleotides to generate sufficient data for fetal aneu(cid:173)
`ploidy detection can be expensive. Methods for randomly
`enriching fetal nucleic acids in cell-free maternal sample have
`been described, including enriching nucleic acids based on
`size, formaldehyde treatment, methylation status, or hybrid(cid:173)
`ization to oligonucleotide arrays. There is a need for a means
`of selectively enriching non-random fetal and maternal poly(cid:173)
`nucleotide sequences in a way that facilitates aneuploidy
`detection by massively parallel sequencing techniques and
`increases the sensitivity of aneuploidy detection.
`
`SUMMARY OF THE INVENTION
`
`In one aspect, a method for determining the presence or
`absence offetal aneuploidy is provided comprising a) selec(cid:173)
`tively enriching non-random polynucleotide sequences of
`genomic DNA from a cell-free DNA sample; b) sequencing
`said enriched polynucleotide sequences; c) enumerating
`sequence reads from said sequencing step; and d) determin(cid:173)
`ing the presence or absence of fetal aneuploidy based on said
`enumerating. In one embodiment, said selectively enriching
`comprises performing PCR. In another embodiment, said
`selectively enriching comprises linear amplification.
`In
`another embodiment, said selectively enriching comprises
`enriching at least 1, 5, 10, 50, 100, or 1000 non-random
`polynucleotide sequences from a first chromosome.
`In
`another embodiment, said selectively enriching comprises
`enriching at least 1, 10, or 100 polynucleotide sequences from 55
`one or more regions of a first chromosome, wherein each
`region is up to 50 kb. In another embodiment, said non(cid:173)
`random polynucleotide sequences comprise sequences that
`are sequenced at a rate of greater than 5-fold than other
`sequences on the same chromosome. In another embodiment,
`said non-random polynucleotide sequences each comprise
`about 50-1000 bases. In another embodiment, said cell-free
`DNA sample is a maternal sample. In another embodiment,
`said maternal sample is a maternal blood sample. In another
`embodiment, said maternal sample comprises fetal and
`maternal cell-free DNA. In another embodiment, said cell(cid:173)
`free DNA is from a plurality of different individuals.
`
`2
`In another embodiment, said sequencing comprises Sanger
`sequencing, sequencing-by-synthesis, or massively parallel
`sequencing.
`In another embodiment, said aneuploidy is trisomy 21,
`trisomy 18, or trisomy 13. In another embodiment, said aneu(cid:173)
`ploidy is suspected or determined when the number of enu(cid:173)
`merated sequences is greater than a predetermined amount. In
`another embodiment, said predetermined amount is based on
`estimated amount of DNA in said cell-free DNA sample. In
`10 another embodiment, said predetermined amount is based on
`the amount of enumerated sequences from a control region.
`In another aspect, a method is provided comprising: a)
`providing