`
`Original Article
`
`
`
`Human Tissue Plasminogen Activator Expression in Escherichia coli using
`Cytoplasmic and Periplasmic Cumulative Power
`
`
`Keivan Majidzadeh-A 1,2, Fereidoun Mahboudi 1, Mahdi Hemayatkar 1, Fatemeh Davami 1,
`Farzaneh Barkhordary 1, Ahmad Adeli 1, Mohammad Soleimani 3,
`Noushin Davoudi 1, and Vahid Khalaj 1*
`
`
`
`1. Biotechnology Department, Biotechnology Research Center, Pasteur Institute of Iran, Tehran, Iran
`2. Iranian Center for Breast Cancer (ICBC), ACECR, Tehran, Iran
`3. Azad University, Qom, Iran
`
`
`
`
`
`
`* Corresponding author:
`Vahid Khalaj, Ph.D.,
`Biotechnology Department,
`Biotechnology Research
`Center, Pasteur Institute of
`Iran, Tehran, Iran
`Tel: +98 21 66480780
`Fax: +98 21 66480780
`E-mail:
`khalajs@pasteur.ac.ir
`Received: 5 Jul 2010
`Accepted: 4 Aug 2010
`
`Downloaded from http://www.ajmb.org
`
`Abstract
`Tissue plasminogen activator (tPA) is a serine protease, which is composed of
`five distinct structural domains with 17 disulfide bonds, representing a model
`of high-disulfide proteins in human body. One of the most important
`limitations for high yield heterologous protein production in Escherichia coli
`(E. coli) is the expression of complex proteins with multiple disulfide bridges. In
`this study the combination of two distinct strategies, manipulated cytoplasm
`and native periplasm, was applied to produce the functional full length tPA
`enzyme in E. coli. Using a PelB signal peptide sequence at 5' site of tPA gene,
`the expression cassette was prepared and subsequently was transformed into
`a strain with manipulated oxidizing cytoplasm. Then the induction was made
`to express the protein of interest. The SDS-PAGE analysis and gelatin
`hydrolysis confirmed the successful expression of functional tPA. The results of
`this study showed that complex proteins can be produced in E. coli using the
`cumulative power of both cytoplasm and periplasm.
`
`Avicenna J Med Biotech 2010; 2(3): 131-136
`
`Keywords: Cytoplasm, Escherichia coli, Periplasm, Proteins, Tissue Plasminogen
`Activator
`
`
`
`
`
`
`
`
`
`Introduction
`Tissue plasminogen activator (tPA) is a
`~64 kDa serine protease that converts the
`plasminogen to plasmin, a serine protease of
`broad specificity that degrades the fibrin
`network in thrombi. tPA is composed of five
`distinct structural domains; a finger region, an
`epidermal growth factor-like sub-domain, two
`kringle domains, and finally, the catalytic
`domain. It is a 527-amino acid protein, with
`35 cysteine residues that participate in forma-
`tion of 17 disulfide bonds, representing a
`
`
`model of high-disulfide proteins in human
`body (1, 2).
`Prokaryotic systems such as E.coli have
`been the most widely used systems for the
`recombinant protein production. This
`is
`mainly due to genetic simplicity, fast growth
`rate, high cell density production and the
`availability of an increasingly large number of
`vectors and host strains (3 - 5). One of the most
`important limitations for high yield heterol-
`ogous protein production in E. coli is the
`
`Copyright © 2010, Avicenna Journal of Medical Biotechnology. All rights reserved. Vol. 2, No. 3, July- September 2010
`
`131
`
`APOTEX EX1059
`Apotex Inc., et al. v. Amgen Inc. et al., IPR2016-01542
`Page 1
`
`

`

`Downloaded from http://www.ajmb.org
`
`Human Tissue Plasminogen Activator Expression
`
`expression of complex proteins with multiple
`disulfide bridges. Among the several factors
`affecting the efficiency of such complex
`proteins production (6 - 9), the reducing envir-
`onment of cytoplasm seems to play a key role
`in improper folding of such high disulfide
`bonded proteins. The periplasm of E.coli is
`more oxidizing environment and in wild type
`bacteria is more suitable than cytoplasm for
`proper folding (3).
`There are two common in vivo approaches
`to improve the conformation of complex
`proteins in E. coli. The first is manipulating
`the condition of cytoplasm by converting its
`reducing nature into an oxidizing environ-
`ment. In this approach the gene of interest,
`without the signal peptide encoding sequence
`is transformed into the engineered E. coli
`strain (10). As a result, the recombinant protein
`maintains in oxidizing environment of cyto-
`plasm and the proper conformation of the
`protein forms.
`In the second approach, the secretion of the
`protein into the less reducing environment of
`periplasm is the main idea. To achieve this
`goal, the gene of interest containing a suitable
`signal peptide is introduced to the bacterial
`host and the signal peptide directs the protein
`into the periplasm.
`The aim of this study was to investigate the
`potential of using a signal peptide for produc-
`tion of a highly disulfide bonded protein in an
`E. coli strain with engineered cytoplasm. So,
`for the first time, we have used both ap-
`proaches by a simple method that can be
`improved in future studies. Using a signal
`peptide sequence at 5' site of tPA gene, the
`expression cassette was prepared and subse-
`quently was transformed into a strain with
`manipulated oxidizing cytoplasm. In this way
`the protein of interest is produced in oxidizing
`environment of cytoplasm and the disulfide
`bonds would be formed to some extent. Then
`signal peptide transfers the produced protein
`into the periplasm where a greater amount of
`the disulfide bonds would be formed in less
`reducing environment of periplasm.
`
`In this introductory study, tPA was cloned
`and expressed in an E.coli strain with oxi-
`dizing specialty. The expression and function
`of tPA were assayed by SDS-PAGE and
`Gelatin Hydrolysis test.
`
`
`Materials and Methods
`Strains, plasmids and culture media
`Escherichia coli strain Top10 F' was used
`as the host for recombinant plasmid. Origami
`B (DE3) was used as expression host.
`pTZ57R (Fermentas, Vinius, Lithuania) as
`T/A cloning vector and pET22b as expression
`vector were used in experiments. pET22b is a
`bacterial vector with the size of 5.5 kb and
`contains PelB sequence for periplasmic local-
`ization. LB agar and Broth were used for
`culturing the strains.
`PCR amplification and cloning of human tPA
`gene
`Genomic DNA of CHO 1-15 cell line
`(ATCC- CRL 9606) transfected by full length
`cDNA of human tPA (GenBank accession
`number 101047), was used as template for
`PCR amplification. FortPA (5’-AACCATGG
`ATGCAATGAAGAGAGGGCTC -3') con-
`taining NotI restriction site and RevtPA (5'-
`GCGGCCGCTCACGGTCGCATGTTG
`-3')
`containing NcoI restriction site were used as
`forward and reverse primers, respectively. A
`high fidelity PCR reaction was set with
`following thermal cycles: 2 min at 95 °C for
`one cycle, and 30 cycles of 1 min at 95 °C,
`45 sec at 68 °C, 2 min at 72 °C, and a final
`extension cycle of 10 min at 72 °C.
`The resulting PCR product was tailed by an
`oligo A at 3' side and subsequently was
`cloned into the pTZ57R vector (Fermentas,
`Vinius, Lithuania), generating pTZ-tPA. Re-
`striction mapping and bidirectional sequenc-
`ing of cloned fragment was performed to
`confirm the construct. To prepare the final
`construct, tPA cloned fragment was cut from
`pTZ-tPA vector using NotI and NcoI enzymes
`and subsequently cloned into pET22b. The
`final construct was called pET/ tPA and con-
`firmed by restriction analysis and sequencing.
`
`
`
`
`
`١٣
`132
`
`Avicenna Journal of Medical Biotechnology, Vol. 2, No. 3, July- September 2010
`
`APOTEX EX1059
`Apotex Inc., et al. v. Amgen Inc. et al., IPR2016-01542
`Page 2
`
`

`

`Majidzadeh K, et al
`
`Downloaded from http://www.ajmb.org
`
`Figure 1. Amplification of tPA cDNA using genomic DNA
`of CHO 1-15 cell line. A specific band of ~1.7 kb was
`amplified (lane 1). Lane 2: size marker
`
`
`
`and correct orientation of insert inside the
`vector (data not shown).
`Expression of recombinant tPA
`Expression of recombinant tPA was induc-
`ed by addition of IPTG as described above. A
`
`Figure 2. Restriction analysis of pTZ/tPA construct. Lane
`1) Size marker. Lane 2) Fragments created by NcoI/NotI
`digestion of the construct; The backbone plasmid (2.9 kb)
`and tPA fragment (1.7 kb) are present. Lane 4) NcoI/NotI
`linearized pET22b plasmid. Lanes 3 and 5 represent
`undigested plasmids
`
`
`
`Transformation of origami B (DE3) cells and
`expression of recombinant tPA
`Competent cell preparation and transform-
`ation was done using standard Calcium
`chloride method. The transformed cells were
`cultured in LB Agar containing Tetracycline.
`For expression experiments, transformants
`were cultured in 5 ml LB broth and the
`induction was carried out by adding IPTG 1M
`at the optical density of 0.3 - 0.5 in 600 nm.
`SDS-PAGE analysis and zymography test
`Cell lysis and SDS-PAGE analysis on 12%
`polyacrylamide gels were performed accord-
`ing to standard methods (11).
`Zymography test was performed as de-
`scribed before (12, 13). Briefly, the protein sam-
`ples were separated on a 11% non-reducing
`SDS-poly acrylamide gel containing appropri-
`ate amount of Plasminogen (Chromogenix,
`Italy) and Gelatin (Sigma, USA). After com-
`plete separation, the gel was soaked in 2.5%
`(w/v) Triton X-100 at room temperature for
`1 hr to remove SDS and then incubated in
`0.1 M glycine/ NaOH (pH= 8.3) for 5 hr at
`37 °C. The gel (zymogram) was subsequently
`stained with Coomassie Brilliant Blue and the
`areas of digestion appeared as clear bands
`against a darkly stained background where the
`substrate has been degraded by the enzyme.
`
`
`Results
`Amplification and cloning of tPA cDNA
`Human
`tPA cDNA was amplified by
`specific primers (Figure 1) and the resulting
`fragment was cloned into pTZ57R; success-
`fully. Figure 2, lane 1 shows the result of
`restriction digestion of pTZ/ tPA by NotI and
`NcoI enzymes which created two fragments;
`the backbone of cloning vector (2.9 kb) and
`tPA fragment.
`The size of expression construct (pET/tPA)
`was 7.2 kb and the restriction map of this
`construct using NotI and NcoI enzymes
`showed two fragments with expected sizes at
`5.5 kb and 1.7 kb, confirming a successful
`sub-cloning of
`tPA gene
`into pET22b
`expression vector (Figure 3). Final sequenc-
`ing of the construct confirmed the presence
`
`Avicenna Journal of Medical Biotechnology, Vol. 2, No. 3, July- September 2010
`
`133
`
`APOTEX EX1059
`Apotex Inc., et al. v. Amgen Inc. et al., IPR2016-01542
`Page 3
`
`

`

`Human Tissue Plasminogen Activator Expression
`
`Downloaded from http://www.ajmb.org
`
`Figure 5. The cell lysate of transformed expression host
`before and after induction were applied to evaluate the
`activity and conformation of recombinant t-PA. Lane 7
`shows the transparent band of cell lysate after induction,
`which indicated that the plasminogen is digested by serine-
`protease activity of t-PA and derived plasmin resulted in
`gelatin hydrolysis. Commercial t-PA (Actylase) was used
`as positive control (Lanes 6). Cell lysate of transformed
`expression host before induction (Lane 5) and negative
`colonies (Lanes1-4) after induction were used as negative
`controls
`induction (arrows).The band related to t-PA
`protein expressed by Origami B (DE3) trans-
`formant is shown by the arrow. Lanes 1 and 3
`show the protein background of expression
`host before induction. The lack of expression
`in columns 1 and 3 shows a tight regulation of
`expression in pET22b vector. Lane 5 re-
`presents the molecular weight marker bands.
`
`Gelatin hydrolysis test
`In Zymography test, the plasminogen and
`gelatin were co-polymerized and immobilized
`with a non-reducing polyacrylamide gel. The
`cell lysate of transformed expression host
`before and after induction were applied to
`evaluate the activity and conformation of
`recombinant tPA (Figure 5). The transparent
`regions on the gel, which was observed only
`in transformed host (Lane 7 of Figure 5), indi-
`cated that the plasminogen is digested by
`serine-protease activity of
`t-PA and
`the
`derived plasmin resulted in gelatin hydrolysis.
`Commercial t-PA (Actylase) was used as
`positive control (Lane 6 of Figure 5). Cell
`lysate of transformed expression host before
`induction was used as negative control (Lanes
`1-5 of Figure 5).
`
`
`Discussion
`Tissue plasminogen activator is an import-
`ant enzyme for biotechnology industry due to
`
`Figure 3. Restriction analysis of pET/tPA construct. Lane 2
`shows two fragments created by NcoI/NotI digestion. The
`back bone plasmid, pET22b vector (5.5 kb), and tPA
`fragment (1.7 kb) are present. Lane 3 shows the undigested
`plasmid. Lane 1: Size marker
`
`
`positive transformant was selected and was
`grown in LB medium until the cell optical
`density (OD, 600 nm) reached to 0.3-0.5.
`Following induction, four hour- samples
`were taken and the lysates of induced and
`non-induced cells were compared
`in a
`standard SDS-Polyacrylamide gel (Figure 4).
`In figure 4, lanes 2 and 4 represent the
`expressed band of tPA in cell lysate of
`recombinant Origami B (DE3) after four hr of
`
`66
`
`45
`35
`
`25
`
`
`
`1 2 3 4 5
`Figure 4. SDS-PAGE analysis of a recombinant clone
`producing tPA. Lanes 1 and 3 show the protein back
`ground of expression host before induction. Lanes 2 and 4
`represent the expressed band of t-PA in cell lysate of
`recombinant Origami B (DE3) after four hours of
`induction. Arrows
`indicate
`the bands
`related
`to
`recombinant tPA
`
`١٣
`134
`
`Avicenna Journal of Medical Biotechnology, Vol. 2, No. 3, July- September 2010
`
`APOTEX EX1059
`Apotex Inc., et al. v. Amgen Inc. et al., IPR2016-01542
`Page 4
`
`

`

`Downloaded from http://www.ajmb.org
`
`Majidzadeh K, et al
`
`its extended application in medicine (14 - 16). It
`is one of the most complex proteins in human
`body and currently is produced in CHO which
`is a mammalian host and so the production
`cost is very high (1). Attempts to produce
`active tPA in Saccharomyces cerevisiae or in
`insect cells have been frustrated by problems
`like hyperglycosylation, poor export, and
`improper folding (17 - 19).
`Due to its high growth rate, easy handling,
`low cost, and the availability of variety of
`strains and vectors, E. coli is a suitable host
`for recombinant production of target proteins.
`In native strains of E. coli the condition of
`periplasm is more suitable for the expression
`of highly disulfide bonded proteins than
`cytoplasm of the cells. Although disulfide
`bond formation usually takes place in peri-
`plasmic space, tPA secreted in the periplasm
`of E. coli was misfolded and completely in-
`active in its primary trials (20).
`The E. coli cytoplasm contains two thio-
`redoxins, TrxA and TrxC, and three gluta-
`redoxins. The oxidized form of these proteins
`can catalyze the formation of disulfide bonds
`in target peptides. In the cytosol, both the
`thioredoxins and the glutaredoxins are main-
`tained in a reduced state by the action of
`thioredoxin reductase (TrxB) and glutathione,
`respectively (21).
`In a trxB null mutant, some disulfide
`bonded proteins such as alkaline phosphatase
`were expressed with proper folding and func-
`tion (13). The expression of disulfide bonded
`proteins was found to be even more efficient
`in double mutants defective cells in both
`thioredoxin (trxB) and glutathione (gor or
`gshA) pathways (22, 23).
`In this study we used Origami B (DE3)
`cell, in which the cytoplasm is engineered
`through a double mutation in both thiored-
`oxin and glutathione genes. Unlike the other
`reports, we have used an expression vector
`carrying a signal sequence. We hypothesized
`that the disulfide bond formation will partly
`take place during protein synthesis in suitable
`environment of origami B cytoplasm and, the
`remaining portion of disulfide bonds would
`
`be formed by directing tPA molecules into the
`periplasmic space through signal peptide.
`Gelatin hydrolysis test is a functional assay
`to show hydrolytic activity of the test protein.
`Using this assay, we showed that the expres-
`sed tPA is active.
`
`
`Conclusion
`Recombinant expression of a highly
`disulfide bonded protein, human t-PA, in E.
`coli was investigated in this study. As the
`functionality of t-PA is highly dependent on
`its proper folding and disulfide bond forma-
`tion, it can be concluded that the application
`of two distinct strategies, manipulated cyto-
`plasm and native periplasm would be an
`effective approach in recombinant production
`of complex proteins.
`
`
`Acknowledgement
`The authors would like to thank Dr.
`Behrouz Vaziri for his valuable comments.
`This work is financially supported by Pasteur
`Institute of Iran.
`
`
`
`
`
`
`References
`1. Pennica D, Holmes WE, Kohr WJ, Harkins RN,
`Vehar GA, Ward CA, et al. Cloning and expression
`of human tissue-type plasminogen activator cDNA
`in E. coli. Nature 1983;301(5897):214-221.
`2. van Zonneveld AJ, Veermanet H, MacDonald ME,
`Pannekoek H, van Mourik JA. Structure and func-
`tion of human tissue-type plasminogen activator (t-
`PA). J Cell Biochem 1986;32(3):169-178.
`3. Gasser B, Saloheimo M, Rinas U, Dragosits M,
`Carmona ER, Baumann K, Giuliani M, et al. Pro-
`tein folding and conformational stress in microbial
`cells producing recombinant protein: a host com-
`parative overview. Microb Cell Fact 2008;7:11.
`4. Verma R, Boleti E, George AJT. Antibody engine-
`ering: comparison of bacterial, yeast, insect and
`mammalian expression
`systems.
`J
`Immunol
`Methods 1998;216(1-2):165-181.
`5. Baneyx F. Recombinant protein expression in
`Escherichia coli. Curr Opin Biotechnol 1999;10(5):
`411-421.
`6. Bardwell JC, McGovern K, Beckwith J. Identifica-
`tion of a protein required for disulfide bond forma-
`tion in vivo. Cell 1991;67(3):581-589.
`7. Kamitani S, Akiyama Y, Ito K. Identification and
`
`
`
`
`
`
`
`
`
`
`Avicenna Journal of Medical Biotechnology, Vol. 2, No. 3, July- September 2010
`
`135
`
`APOTEX EX1059
`Apotex Inc., et al. v. Amgen Inc. et al., IPR2016-01542
`Page 5
`
`

`

`Human Tissue Plasminogen Activator Expression
`
`Downloaded from http://www.ajmb.org
`
`16. Van de Werf F, Ludbrook PA, Bergmann SR,
`Tiefenbrunn AJ, Fox KAA, de Geest H, et al.
`Coronary
`thrombolysis with
`tissue-type plas-
`minogen activator in patients with evolving myo-
`cardial infarction. N Engl J Med 1984;310(10):
`609-613.
`17. Martegani E, Forlani N, Mauri I, Porro D,
`Schleuning WD, Alberghina L. Expression of high
`levels of human tissue plasminogen activator in
`yeast under the control of an inducible GAL
`promoter. Appl Microbiol Biotechnol 1992;37(5):
`604-608.
`18. Furlong AM, Thomsen DR, Marotti KR, Post LE,
`Sharma SK. Active human tissue plasminogen
`activator secreted from insect cells using a baculo-
`virus vector. Biotechnol Appl Biochem 1988;10(5):
`454-464.
`19. Steiner H, Pohl G, Gunne H, Hellers M, Elhammer
`A, Hansson L. Human tissue-type plasminogen
`activator synthesized by using a baculovirus vector
`in insect cells compared with human plasminogen
`activator produced in mouse cells. Gene 1988;73
`(2):449-457.
`20. Nakamoto H, Bardwell JC. Catalysis of disulfide
`bond formation and isomerization in the Escherich-
`ia coli periplasm. Biochim et Biophysica Acta
`2004;1694(1-3):111-119.
`21. Aslund F, Beckwith J. The thioredoxin super-
`family: redundancy, specificity, and gray-area
`genomics. J Bacteriol 1999;181(5):1375-1379.
`22. Bessette PH, Aslund F, Beckwith J, Georgiou G.
`Efficient folding of proteins with multiple disulfide
`bonds in the Escherichia coli cytoplasm. Proc Natl
`Acad Sci USA 1999;96(24):13703-13708.
`23. Stewart EJ, Aslund F, Beckwith J. Disulfide bond
`formation in the Escherichia coli cytoplasm: an in
`vivo role reversal for the thioredoxins. EMBO J
`1998;17(19):5543-5550.
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`characterization of an Escherichia coli gene re-
`quired for the formation of correctly folded alkaline
`phosphatase, a periplasmic enzyme. EMBO J 1992;
`11(1):57-62.
`8. Peek JA, Taylor RK. Characterization of a peri-
`plasmic thiol: disulfide interchange protein required
`for the functional maturation of secreted virulence
`factors of Vibrio cholerae. Proc Natl Acad Sci USA
`1992;89(13):6210-6214.
`9. Hua Q, Yang C, Oshima T, Mori H, Shimizu K.
`Analysis of gene expression in Escherichia coli in
`response to changes of growth-limiting nutrient in
`chemostat cultures. Appl Environ Microbiol 2004;
`70(4):2354-2366.
`
`10. Mattes R. The production of improved tissue-type
`plasminogen activator in Escherichia coli. Semin
`Thromb Hemost 2001;27(4):325-336.
`
`11. Ausubel FM. Current protocols
`in molecular
`biology. New York: John Wiley & Sons; 1987.
`
`12. Snoek-van Beurden PA, Von den Hoff JW.
`Zymographic techniques for the analysis of matrix
`metalloproteinases and their inhibitors. Biotech-
`niques 2005;38(1):73-83.
`
`13. Soleimani M, Mahboudi F, Davoudi N, Amanzadeh
`A, Azizi M, Adeli A, et al. Expression of human
`tissue plasminogen activator in the trypanosomatid
`protozoan Leishmania tarentolae. Biotechnol Appl
`Biochem 2007;48(Pt 1):55-61.
`
`14. Bergmann SR, Fox KA, Ter-Pogossian MM, Sobel
`BE, Collen D. Clot-selective coronary thrombolysis
`with tissue-type plasminogen activator. Science
`1983;220(4602):1181-1183.
`
`15. Van de Werf F, Bergmann SR, Fox KA, de Geest
`H, Hoyng CF, Sobel BE, et al. Coronary thrombo-
`lysis with intravenously administered human tissue-
`type plasminogen activator produced by recombi-
`nant DNA technology. Circulation 1984;69(3):
`605-610.
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`١٣
`136
`
`Avicenna Journal of Medical Biotechnology, Vol. 2, No. 3, July- September 2010
`
`APOTEX EX1059
`Apotex Inc., et al. v. Amgen Inc. et al., IPR2016-01542
`Page 6
`
`