- MOLECULAR BIOLQGH OF
`
`
`
`- Definis Bray ' Julian Lesa/is
`Bruce Alber
`Malitifi Rafi" - Keith Roberis ° James 1). Watson
`
`1
`
`TFS1 035
`
`1
`
`1
`
`TFS1035
`
`

`

`MOLECULAR BIOLOGY OF
`
`THE CELL
`
`SECOND EDITION
`
`Bruce Alberts (cid:149) Dennis Bray
`Julian Lewis (cid:149) Martin Raff . Keith Roberts
`James D. Watson
`
`@~~p
`
`Garland Publishing, Inc.
`New York & London
`
`2
`
`

`

`TEXT sorrOs: Miranda Robertson
`
`GARLAND STAFF
`
`Managing Editor: Ruth Adams
`Project Editor: Alison Walker
`Production Coordinator: Perry Bessas
`Designer: Janet Koenig
`Copy Editors: Lynne Lackenbach and Shirley Cobert
`Editorial Assistant: Mªra Abens
`Art Coordinator: Charlotte Staub
`Indexer: Maija Hinkle
`
`Bruce Alberts received his Ph.D. from Harvard University and is
`currently Chairman of the Department of Biophysics and
`Biochemistry at the University of California Medical School in San
`Francisco. Dennis Bray received his Ph.D. from the Massachusetts
`Institute of Technology and is currently a Senior Scientist in the
`Medical Research Council Cell Biophysics Unit at Kings College
`London. Julian Lewis received his D.Phil. from Oxford University and
`is currently a Senior Scientist in the Imperial Cancer Research Fund
`Developmental Biology Unit, Dept. of Zoology, Oxford University.
`Martin Raff received his M.D. degree from McGill University and is
`currently a Professor in the Biology Department at University College
`London. Keith Roberts received his Ph.D. from Cambridge University
`and is currently Head of the Department of Cell Biology at the John
`Inries Institute, Norwich. James D. Watson received his Ph.D. from
`Indiana University and is currently Director of the Cold Spring
`Harbor Laboratory. He is the author of Molecular Biology of the Gene
`and, with Francis Crick and Maurice Wilkins, won the Nobel Prize in
`Medicine and Physiology in 1962.
`
`' 1989 by Bruce Alberts, Dennis Bray, Julian Lewis, Martin Ralf,
`Keith Roberts, and James D. Watson.
`
`All rights reserved. No part of this book covered by the copyright
`hereon may be reproduced or used in any form or by any means(cid:151)
`graphic, electronic, or mechanical, including photocopying,
`recording, taping, or information storage and retrieval systems(cid:151)
`without permission of the publisher.
`
`Library of Congress Cataloging-in-Publication Data
`
`Molecular biology of the cell / Bruce Alberts ... [et a].].-2nd ed.
`p. cm.
`
`Includes bibliographies and index.
`ISBN 0-8240-3695-6.(cid:151)ISBN 0-8240-3696-4 (pbk.)
`1. Cytology. 2. Molecular biology. I. Alberts, Bruce.
`[DNLM: 1. Cells. 2. Molecular Biology. (cid:9)
`QH 581.2 M7181
`QH581.2.M64 1989
`574.87(cid:151)dcl9
`DNLM/DLC
`for Library of Congress (cid:9)
`
`88-38275
`CIP
`
`Published by Garland Publishing, Inc.
`136 Madison Avenue, New York, NY 10016
`
`Printed in the United States of America
`
`15 14 13 12 11 10 9 8 7 6
`
`5 4 3 2 1
`
`3
`
`

`

`h T
`
`able 3—3 The Relationship
`Between Free—Energy Differences
`and Equilibrium Constants
`
`Free Energy of
`Equilibrium
`AB Minus
`Constant
`Free Energy
`[AB] = K
`[MW]
`of A + B
`
`(liters/mole)
`(kcal/mole)
`
`— 7.1
`10s
`—5.7
`104
`~ 4.3
`103
`-—2.8
`102
`— 1.4
`10
`0
`1
`1 .4
`10 _ 1
`2.8
`10 _ 2
`4.3
`10 " 3
`5 .7
`10 ' 4
`
`10 T 5 7.1
`
`If the reaction A + B : AB is allowed to
`come to equilibrium, the relative amounts
`of A, B, and AB will depend on the free—
`energy difl’erence, AG", between them. The
`above values are given for 37°C (310° K)
`and are calculated from the equation
`[AB]
`
`AG° = —RT1
`
`01‘
`
`n [AliBl
`
`[AB] _
`[A][Bl ‘
`
`- AG°/RT : e — AG°(1.623)
`
`Here AG" is in kilocalories per mole and
`represents the free-energy difference
`under standard conditions (where all
`components are present at a
`concentration of 1.0 mole/liter); T is the
`temperature in kelvins (K).
`Similar principles apply to the even
`simpler case of a reaction A :3 A*, where a
`molecule is interconvertible between two
`states A and A" differing in free energy by
`an amount AG". The quantities of
`molecules in the two states at equilibrium
`will be in the ratio
`
`[Afl _ —AG°/HT
`[A] ‘ e
`which is the same as the ratio of
`probabilities for a single molecule to be
`found in one or the other of the two
`states.
`
`r1f
`
`On the other hand, errors are essential to life as we know it. If it were not for
`Ccasional mistakes in the maintenance of DNA sequences, evolution could not
`ccur (see p. 97, below).
`
`0 o
`
`Summary
`
`The sequence ofsubunits in a macromolecule contains information that determines
`the three-dimensional contours of its surface. These contours in turn govern the
`regagnition between one molecule and another, or between different parts of the
`same molecule, by means of weak noncovalent bonds. Molecules are constantly in
`rapid motion, and they recognize each other by a process in which theyfirst meet
`by random difl‘irsion and then bind with a strength that can be expressed in terms
`of an equilibrium constant. Since the only way to make recognition infallible is to
`make the energy ofbinding infinitely large, living cells constantly make errors; those
`that are intolerable are corrected by specrfic repair processes.
`
`Nucleic Acids8
`
`yaw:
`
`Genes Are Made of DNA9
`
`It has been obvious for as long as humans have sown crops or raised animals that
`each seed or fertilized egg must contain a hidden plan, or design, for the devel-
`opment of the organism. In modern times the science of genetics grew up around
`the premise of invisible information-containing elements, called genes, that are
`distributed to each daughter cell when a cell divides. Before dividing, therefore, a
`cell has to make a copy of its genes in order to give a complete set to each daughter
`cell. The genes in the sperm and egg cells carry the hereditary information from
`one generation to the next.
`The inheritance of biological characteristics must involve patterns of atoms
`that follow the laws of physics and chemistry: in other words, genes must be
`formed from molecules. At first the nature of these molecules was hard to imagine.
`What kind of molecule could be stored ina cell and direct the activities of a
`developing organism and also be capable of accurate and almost unlimited
`replication?
`
`By the end of the nineteenth century, biologists had recognized that the car-
`riers of inherited information were the chromosomes that become visible in the
`nucleus as a cell begins to divide. But the evidence that the deoxyribonucleic acid
`(DNA) in these chromosomes is the substance of which genes are made came only
`much later, from studies on bacteria. In 1944 it was shown that adding purified
`DNA from one strain of bacteria to a second, slightly different bacterial strain
`conferred heritable properties characteristic of the first strain upon the second.
`BeCause it had been commonly believed that only proteins have enough confor—
`mational complexity to carry genetic information, this discovery came as a sur—
`pIiSe, and it was not generally accepted until the early 19505. Today the idea that
`DNA Carries genetic information in its long chain of nucleotides is so fundamental
`to biological thought that it is sometimes difficult to realize the enormous intel-
`lectual gap that it filled.
`
`DNA Molecules Consist of Two Long Chains Held Together
`by Complementary Base Pairs10
`The difficulty that geneticists had in accepting DNA as the substance of genes is
`undemiandable, considering the simplicity of its chemistry. A DNA chain is a long,
`unbl‘flnched polymer composed of only four types of subunits. These are the
`deOXF/II'Illborrucleotides containing the bases adenine (A), cytosine (C), guanine (G),
`2nd mil/Milne (T). The nucleotides are linked together by covalent phosphodiester
`“Uncle that join the 5’ carbon of one deoxyribose group to the 3’ carbon of the
`8:“ (Panel 2—6, pp. 56—57). The four kinds of bases are attached to this repetitive
`galll‘lllmSphate chain almost like four kinds of beads strung on a necklace.
`
`95
`
`Nucleic Acids
`
`L
`
`4
`
`

`

`Figure 3*8 A short section of a DNA
`double helix. Four complementary base
`pairs are shown. The bases are shown
`in color, while the deoxyribose sugars
`are gray. Note that the two DNA strands
`run in opposite directions and that
`each base pair is held together by either
`two or three hydrogen bonds (see also
`Panel 3—2, pp. 98—99).
`
`
`
`up»;-.,‘”Leila.as......
`
`awn-sf
`
`
`
`
`
`
`
`phosphod iester
`bond
`
`How can a long chain of nucleotides encode the instructions for an organism
`or even a cell? And how can these messages be copied from one generation of
`cells to the next? The answers lie in the structure of the DNA molecule.
`Early in the 1950s, x-ray diffraction analyses of specimens of DNA pulled into
`fibers suggested that the DNA molecule is a helical polymer composed of two
`strands. The helical structure of DNA was not surprising since, as we have seen,
`a helix will often form if each of the neighboring subunits in a polymer is regularly
`oriented. But the finding that DNA is two-stranded was of crucial significance. It
`provided the clue that led, in 1953, to the construction of a model that fitted the
`observed x-ray diffraction pattern and thereby solved the puzzle of DNA structure
`and function (Figure 3—8 and Panel 3—2, pp. 98—99).
`An essential feature of the model was that all of the bases of the DNA molecule
`are on the inside of the double helix, with the sugar phosphates on the outside.
`This demands that the bases on one strand be extremely close to those on the
`other, and the fit proposed required specific base-pairing between a large purine
`base (A or G, each of which has a double ring) on one chain and a smaller pyrim-
`idine base (T or C, each of which has a single ring) on the other chain.
`Both evidence from earlier biochemical experiments and conclusions derived
`from model building suggested that complementary base pairs (also called Watson-
`Crick base pairs) form between A and T and between G and C. Biochemical anal-
`yses of DNA preparations from different species had shown that, although the
`nucleotide composition of DNA varies a great deal (for example, from 13% A resi—
`dues to 36% A residues in the DNA of different types of bacteria), there is a general
`rule that, quantitatively, [G] = [C] and [A] = [T]. Model building revealed that the
`numbers of effective hydrogen bonds that could be formed between G and C or
`between A and T were greater than for any other combinations. The double-helical
`model for DNA thus neatly explained the quantitative biochemistry.
`
`The Structure of DNA Provides an Explanation for Heredity11
`A gene carries biological information in a form that must be precisely copied and
`transmitted from each cell to all of its progeny. The implications of the discovery
`of the DNA double helix were profound because the structure immediately sug—
`gested how information transfer could be accomplished. Since each strand con—
`tains a nucleotide sequence that is exactly complementary to the nucleotide se—
`quence ofits partner strand, both strands actually carry the same genetic information.
`If we designate the two strands A and A', strand A can serve as a mold or template
`for making a new strand A’, while strand A' can serve in the same way to make a
`new strand A. Thus, genetic information can be copied by a process in which
`strand A separatesfrom strand A’ and each separated strand then serves as a
`template for the production of a new complementary partner strand.
`
`93
`
`Chapter 3 I Macromolecules: Structure, Shape, and Information
`5
`
`5
`
`

`

`.7"
`
`AS a direct consequence of the base-pairing mechanism, it becomes evident
`. DNA carries information by means of the linear sequence of its nucleotides.
`{hath nucleotide—A, C, T, or G—can be considered a letter in a four-letter alphabet
`Eac is used to write out biological messages in a linear ”ticker-tape" form. Orga-
`fllat s differ because their respective DNA molecules carry different nucleotide
`msmences and therefore different biological messages.
`sequSirlce the number of possible sequences in a DNA chain It nucleotides long
`.
`4n the biological variety that could in principle be generated using even a
`Is d’esl length of DNA is enormous. A typical animal cell contains a meter of DNA
`(r216; 109 nucleotides). Written in a linear alphabet of four letters, an unusually
`small human gene would occupy a quarter of a page of text (Figure 3—9), while
`the genetic information carried in a human cell would fill a book of more than
`500,000 Pages-
`Although the principle underlying gene replication is both elegant and simple,
`the actual machinery by which this copying is carried out in the Call is complicated
`and involves a complex of proteins that forms a "replication machine” (see p. 232).
`The fundamental reaction is that shown in Figure 3—10, in which the enzyme DNA
`polymerase catalyzes the addition of a deoxyribonucleotide to the 3’ end of a DNA
`chain. Each nucleotide added to the chain is a deoxyribonucleoside triphosphate;
`the release of pyrophosphate from this activated nucleotide and its subsequent
`hydrolysis provide the energy for the DNA replication reaction and make it effec-
`tively irreversible (see pp. 227—238).
`Replication of the DNA helix begins with the local separation of its two com-
`plementary DNA strands. Each strand then acts as a template for the formation
`of a new DNA molecule by the sequential addition of deoxyribonucleoside tri-
`phosphates. The nucleotide to be added at each step is selected by a process that
`requires it to form a complementary base pair with the next nucleotide in the
`parental template strand, thereby generating a new DNA strand that is comple-
`mentary in sequence to the template strand (Figure 3—10). Eventually the genetic
`information is duplicated in its entirety so that two complete DNA double helices
`are formed, each identical in nucleotide sequence to the parental DNA helix that
`served as the template. Since each daughter DNA molecule ends up with one of
`the original strands plus one newly synthesized strand, the mechanism of DNA
`replication is said to be semiconservative (Figure 3—11).
`
`
`
`.sv
`
`“um
`
`Errors in DNA Replication Cause Mutations12
`
`One of the most impressive features of DNA replication is its accuracy. Several
`proofreading mechanisms are used to eliminate incorrectly positioned nucleo—
`tides; as a result, the sequence of nucleotides in a DNA molecule is copied with
`fewer than one mistake in 109 nucleotides added. Very rarely, however, the repli-
`Cation machinery skips or adds a few nucleotides, or puts a T where it should
`have put a C, or an A instead of a G. Any change of this kind in the DNA sequence
`COnstitutes a genetic mistake, called a mutation, which will be copied in all future
`cell generations, since “wrong” DNA sequences are copied as faithfully as "correct”
`ones, The consequence of such an error can be great, since even a single nucleo—
`tide change can have important effects on the cell, depending on where the mu-
`tation has occurred.
`.
`Geneticists demonstrated conclusively in the early 19408 that genes specify
`the Structure of individual proteins. Thus a mutation in a gene, caused by an
`alteration in its DNA Sequence, may lead to the inactivation of a crucial protein
`
`Figure 359 The DNA sequence of the human gene for B-globin
`(one of the two subunits of the hemoglobin molecule that carries
`oxygen in the blood of all adults). Only one of the two DNA
`strands is shown.(the "coding strand”), since the other strand
`has a precisely complementary sequence. The sequence should
`be read from left to right in successive lines down the page, as if
`it were normal English text.
`
`97
`
`Nucleic Acids
`
`La
`
`6
`
`CCCTGTGGAGCCACACCCTAGGGTTGGCCA
`ATCTACTCCCAGGAGCAGGGAGGGCAGGAG
`CCAGGGCTGGGCATAAAAGTCAGGGCAGAG
`CCATCTATTGCTTACATTTGCTTCTGACAC
`AACTGTGTTCACTAGCAACTCAAACAGACA
`CCATGGTGCACCTGACTCCTGAGGAGAAGT
`CTGCCGTTACTGCCCTGTGGGGCAAGGTGA
`ACGTGGATGAAGTTGGTGGTGAGGCCCTGG
`GCAGGTTGGTATCAAGGTTACAAGACAGGT
`TTAAGGAGACCAATAGAAACTGGGCATGTG
`GAGACAGAGAAGACTCTTGGGTTTCTGATA
`GGCACTGACTCTCTCTGCCTATTGGTCTAT
`TTTCCCACCCTTAGGCTGCTGGTGGTCTAC
`CCTTGGACCCAGAGGTTCTTTGAGTCCTTT
`GGGGATCTGTCCACTCCTGATGCTGTTATG
`GGCAACCCTAAGGTGAAGGCTCATGGCAAG
`AAAGTGCTCGGTGCCTTTAGTGATGGCCTG
`GCTCACCTGGACAACCTCAAGGGCACCTTT
`GCCACACTGAGTGAGCTGCACTGTGACAAG
`CTGCACGTGGATCCTGAGAACTTCAGGGTG
`AGTCTATGGGACCCTTGATGTTTTCTTTCC
`CCTTCTTTTCTATGGTTAAGTTCATGTCAT
`AGGAAGGGGAGAAGTAACAGGGTACAGTTT
`AGAATGGGAAACAGACGAATGATTGCATCA
`GTGTGGAAGTCTCAGGATCGTTTTAGTTTC
`TTTTATTTGCTGTTCATAACAATTGTTTTC
`TTTTGTTTAATTCTTGCTTTCTTTTTTTTT
`CTTCTCCGCAATTTTTACTATTATACTTAA
`TGCCTTAACATTGTGTATAACAAAAGGAAA
`TATCTCTGAGATACATTAAGTAACTTAAAA
`AAAAACTTTACACAGTCTGCCTAGTACATT
`ACTATTTGGAATATATGTGTGCTTATTTGC
`ATATTCATAATCTCCCTACTTTATTTTCTT
`TTATTTTTAATTGATACATAATCATTATAC
`ATATTTATGGGTTAAAGTGTAATGTTTTAA
`TATGTGTACACATATTGACCAAATCAGGGT
`AATTTTGCATTTGTAATTTTAAAAAATGCT
`TTCTTCTTTTAATATACTTTTTTGTTTATC
`TTATTTCTAATACTTTCCCTAATCTCTTTC
`TTTCAGGGCAATAATGATACAATGTATCAT
`GCCTCTTTGCACCATTCTAAAGAATAACAG
`TGATAATTTCTGGGTTAAGGCAATAGCAAT
`ATTTCTGCATATAAATATTTCTGCATATAA
`ATTGTAACTGATGTAAGAGGTTTCATATTG
`CTAATAGCAGCTACAATCCAGCTACCATTC
`TGCTTTTATTTTATGGTTGGGATAAGGCTG
`GATTATTCTGAGTCCAAGCTAGGCCCTTTT
`GCTAATCATGTTCATACCTCTTATCTTCCT
`CCCACAGCTCCTGGGCAACGTGCTGGTCTG
`TGTGCTGGCCCATCACTTTGGCAAAGAATT
`CACCCCACCAGTGCAGGCTGCCTATCAGAA
`AGTGGTGGCTGGTGTGGCTAATGCCCTGGC
`CCACAAGTATCACTAAGCTCGCTTTCTTGC
`TGTCCAATTTCTATTAAAGGTTCCTTTGTT
`CCCTAAGTCCAACTACTAAACTGGGGGATA
`TTATGAAGGGCCTTGAGCATCTGGATTCTG
`CCTAATAAAAAACATTTATTTTCATTGCAA
`TGATGTATTTAAATTATTTCTGAATATTTT
`ACTAAAAAGGGAATGTGGGAGGTCAGTGCA
`TTTAAAACATAAAGAAATGATGAGCTGTTC
`AAACCTTGGGAAAATACACTATATCTTAAA
`CTCCATGAAAGAAGGTGAGGCTGCAACCAG
`CTAATGCACATTGGCAACAGCCCCTGATGC
`
`CTATGCCTTATTCATCCCTCAGAAAAGGAT
`TCTTGTAGAGGCTTGATTTGCAGGTTAAAG
`TTTTGCTATGCTGTATTTTACATTACTTAT
`TGTTTTAGCTGTCCTCATGAATGTCTTTTC
`
`6
`
`

`

`
`DNA and RNA The structure of RNA is shown in this half
`
`
`
`of the panel, while the structure of DNA is shown in the
`other half. Both DNA and RNA are linear polymers of
`nucleotides (see Panel 2—6, p. 00-00). RNA differs from
`DNA in three ways:
`(1) The sugar phosphate backbone
`contains ribose rather than deoxyribose; (2) it contains
`the base uracil (U) instead of thymine (T); and (3) it exists
`as a single strand rather than as a doublestranded helix.
`
`
`
`
`
`
`SUGAR-PHOSPHATE BACKBONE OF RNA
`
` 3' linkage
`
`phosphodiester bond
`
`5’ linkage
`
`
`
`
`
`
`
`
`
`
`
`
`FOUR BASES OF RNA
`guanine
`
`cytosine
`
`uracil
`
`adenine
`
`o |C
`
`
`
`
`
` sugar-phosphate backbone
`
`5’.
`
`
`
`
`
`
`hydrogen
`bonds
`
`U
`
`RNA SlNG LE STRAND
`
`RNA is singlestranded, but it contains local regions of short
`complementary base-pairing that can form from a random matching
`process. Regions of base-pairing can be seen in the electron micro-
`graph as branches off the stretched-out chain.
`
` ELECTRON MICROGRAPH OF RNA
`
`7
`
`

`

`3’ linkage
`
`5’ linkage
`
`phosphodiester bond
`
`thymine
`
`Z—-ImmmO /
`
`.
`
`cytosine
`
`/
`
`I
`
`IllllllllO
`I\Z——I /
`
`—Illlllllll
`
`
`
`Olllllllll1‘—Z
`
`\\
`
`/
`hydrogen
`bond
`
`HECTRONRMCROGRAPHOFDNA
`
`sugar-phosphate backbone
`
`Specific hydrogen bonding between G and C and between A and
`T (A and U in RNA) generates complementary base-pairing.
`
`major groove
`
`DNA
`DOUELE
`HEUX
`
`In a DNA molecule, two
`antiparallel strands that are
`complementary in their
`nucleotide sequence are
`paired in a right-handed
`double helix with about
`10 nucleotide pairs per
`helical turn. A schematic
`representation (top) and
`a spacefilling model
`(botrom) are illustrated here.
`
`' sugar-phosphate
`backbone
`
`hydrogen
`bonds
`
`
`‘L.T—':‘-:'z§.."'-'—.—_-'.-"..
`
`
`
`"".""‘"."="r_.'-_.E_-F'm;;—_
`
`.emu—w“;
`
`_=;;-..-E"?
`
`8
`
`

`

`newly synthesized
`strand
`
`
`
`
`
`
`incoming ribonucleoside
`triphosphate
`
`
`
`and result in cell death, in which case the mutation is lost. 0n the other hand, a
`mutation may occur in a nonessential region and be without effect, a so-called
`silent mutation. Very rarely, a mutation creates a gene with an improved or novel
`useful function. In this case, organisms carrying the mutation will have an advan-
`tage, and the mutated gene may eventually replace the original gene in the pop-
`ulation through natural selection.
`
`The Nucleotide Sequence of a Gene Determines the
`Amino Acid Sequence of a Protein13
`
`
`
`
`
`I
`
`
`
`DNA is relatively inert chemically. The information it contains is expressed indi-
`rectly via other molecules: DNA directs the synthesis of specific RNA and protein
`molecules, which in turn determine the cell’s chemical and physical properties.
`At about the time that biophysicists were analyzing the three-dimensional
`structure of DNA by x—ray diffraction, biochemists were intensively studying the
`chemical structure of proteins. It was already known that proteins are chains of
`amino acids joined together by sequential peptide linkages; but it was only in the
`early 1950s, when the small protein insulin was sequenced (Figure 3—12.), that it
`was discovered that each type of protein consists of a unique sequence of amino
`acids. Just as solving the structure of DNA was seminal in understanding the
`daughter DNA helices
`molecular basis of genetics and heredity, so sequencing insulin provided a key to
`.
`understanding the structure and function of proteins. If insulin had a definite,
`Figure ‘3“11 The semiconsewative
`genetically determined sequence, then presumably so did every other protein. It
`replication 0f DNA' In eaCh round 0f
`seemed reasonable to suppose, moreover, that the properties of a protein would
`de
`01 on th
`ci
`der in which its constitutent amino acids are arran ed. mphqamn’ each 0f the two strands 0f
`pen
`e Pre se or
`_
`_
`g
`DNA 1s used as a template for the
`Both DNA and protein are composed of a linear sequence of subunits, and
`formation of a complementary DNA
`eventually the analysis of the proteins made by mutant genes demonstrated that
`strand. The original strands therefore
`the two sequences are co-linear—that is, the nucleotides in DNA are arranged in
`remain intact through many cell
`an order corresponding to the order of the amino acids in the protein they specify.
`generations.
`100
`Chapter 3 l Macromolecules: Structure, Shape, and Ingrmation
`
`REPLICATION
`x
`5( jg
`2
`§ §
`5
`’
`
`;\/
`
`l
`
`
`
`Figure 3—10 Addition of a
`deoxyribonucleotide to the 3’ end of a
`polynucleotide chain is the
`fundamental reaction by which DNA is
`synthesized. As shown, base-pairing
`between this incoming
`deoxyribonucleotide and an existing
`strand of DNA (the template strand)
`guides the formation of a new strand of
`DNA with a complementary nucleotide
`sequence..
`
`parental DNA double helix
`
`REPLICATlON
`
`NEPLICATION
`
`yen/1m
`WW
`m3mm
`yWNW MW
`5mwm
`’\\/’“\W
`mm.o
`
`v“W3x
`
`l
`
`)3
`
`9
`
`