`Akeson et al.
`
`USOO6936433B2
`(10) Patent No.:
`US 6,936,433 B2
`(45) Date of Patent:
`Aug. 30, 2005
`
`(54) METHODS AND DEVICES FOR
`CHARACTERIZING DUPLEX NUCLEC
`ACID MOLECULES
`
`(75) Inventors: Mark Akeson, Santa Cruz, CA (US);
`Wenonah Vercoutere, Santa Cruz, CA
`(US); David Haussler, Santa Cruz, CA
`(US); Stephen Winters-Hilt, Santa
`Cruz, CA (US)
`(73) Assignee: The Regents of the University of
`California, Oakland, CA (US)
`Subject to any disclaimer, the term of this
`patent is extended or adjusted under 35
`U.S.C. 154(b) by 263 days.
`
`(*) Notice:
`
`(21) Appl. No.: 09/990,102
`(22) Filed:
`Nov. 21, 2001
`(65)
`Prior Publication Data
`US 2003/0099951A1 May 29, 2003
`Related U.S. Application Data
`(60) Provisional application No. 60/253,393, filed on Nov. 27,
`2000.
`
`(51) Int. Cl............................. C12Q 1/37; C12O 1/00;
`C12O 1/68; G01N 33/53
`(52) U.S. Cl. ............................... 435/23; 435/24; 435/6;
`435/4; 435/975
`(58) Field of Search ................................ 435/23, 24, 6,
`435/4, 975
`
`(56)
`
`References Cited
`U.S. PATENT DOCUMENTS
`
`5,573.905 A 11/1996 Lerner et al.
`5,723,598 A 3/1998 Lerner et al.
`5,760,190 A 6/1998 Cigan et al. ................ 530/370
`6,015,714 A 1/2000 Baldarelli et al.
`
`FOREIGN PATENT DOCUMENTS
`
`WO
`
`WO 96/29593
`
`9/1996
`
`WO
`WO
`WO
`WO
`
`* 8/1998
`WO 98/35O12
`5/2000
`WOOO/28312
`3/2001
`WO 01/18251
`6/2001
`WO 01/42782
`OTHER PUBLICATIONS
`Burges et al., “A Tutorial on Support Vector Machines for
`Pattern Recognition' Data Mining and Knowledge Discov
`ery,
`Kluwer Academic
`Publishers,
`Netherlands,
`2(2):121–167 (1998).
`Deamer et al., “Characterization of Nucleic Acids by Nan
`opore Analysis” Acc. Chem. Res. 35:817–825 (2002).
`Deamer et al., “Nanopores and nucleic acids: prospects for
`ultrarapid sequencing Trends in Biotechnology 18:147-151
`(Apr. 2000).
`
`(Continued)
`Primary Examiner Louise N. Leary
`(74) Attorney, Agent, or Firm-Bret E. Field, Bozicevic,
`Field & Francis LLP
`ABSTRACT
`(57)
`Methods and devices are provided for characterizing a
`duplex nucleic acid, e.g., a duplex DNA molecule. In the
`Subject methods, a fluid conducting medium that includes a
`duplex nucleic acid molecule is contacted with a nanopore
`under the influence of an applied electric field and the
`resulting changes in current through the nanopore caused by
`the duplex nucleic acid molecule are monitored. The
`observed changes in current through the nanopore are then
`employed as a set of data values to characterize the duplex
`nucleic acid, where the Set of data values may be employed
`in raw form or manipulated, e.g., into a current blockade
`profile. Also provided are nanopore devices for practicing
`the Subject methods, where the Subject nanopore devices are
`characterized by the presence of an algorithm which directs
`a processing means to employ monitored changes in current
`through a nanopore to characterize a duplex nucleic acid
`molecule responsible for the current changes. The Subject
`methods and devices find use in a variety of applications,
`including, among other applications, the identification of an
`analyte duplex DNA molecule in a Sample, the Specific base
`Sequence at a single nulceotide polymorphism (SNP), and
`the Sequencing of duplex DNA molecules.
`20 Claims, 18 Drawing Sheets
`
`
`
`Oxford, Exh. 1014, p. 1
`
`
`
`US 6,936,433 B2
`Page 2
`
`OTHER PUBLICATIONS
`-
`-
`-
`-
`-
`-
`-
`-
`-
`Vercoutere et al., “Rapid discrimination among individual
`DAN hairpin molecules at Single-nucleotide resolution
`using an ion channel.” Nature Biotechnology, 19:248-252
`(Mar. 2001).
`
`Akeson et al., Biophys.J. (1999) 77:3227-3233.
`Kasianowicz, et al., Proc. Natl. Acad. Sci. USA (1996) 93:
`1377O 13773
`Wonderlin et al., BiophvS. J. (1990) 58:289-297
`onderlin et al., BiophyS. J. (
`) 58:
`* cited by examiner
`
`Oxford, Exh. 1014, p. 2
`
`
`
`U.S. Patent
`
`Aug. 30, 2005
`
`Sheet 1 of 18
`
`US 6,936,433 B2
`
`
`
`Figure 1
`
`Oxford, Exh. 1014, p. 3
`
`
`
`U.S. Patent
`
`Aug. 30, 2005
`
`Sheet 2 of 18
`
`US 6,936,433 B2
`
`
`
`y = - 0.56x - 1.62
`R2 = 0.99
`
`A G° (kcal/mol)
`
`Figure 2
`
`Oxford, Exh. 1014, p. 4
`
`
`
`U.S. Patent
`
`Aug. 30, 2005
`
`Sheet 3 of 18
`
`US 6,936,433 B2
`
`
`
`102
`
`109
`
`10?
`Duration (ms)
`
`10.
`
`106
`
`Figure 3a
`
`Oxford, Exh. 1014, p. 5
`
`
`
`U.S. Patent
`
`Aug. 30, 2005
`
`Sheet 4 of 18
`
`US 6,936,433 B2
`
`1OOO
`
`
`
`ge
`
`100
`
`as
`8
`E
`s
`Z
`
`10
`
`Rejection
`Rei
`gion
`
`:
`
`-3.
`
`-2.
`
`-1.
`
`O
`
`1.O
`
`2.0
`
`3.0
`
`SWM Score
`
`Figure 3b
`
`Oxford, Exh. 1014, p. 6
`
`
`
`U.S. Patent
`
`Aug. 30, 2005
`
`Sheet 5 of 18
`
`US 6,936,433 B2
`
`SEQDNO:17
`
`SEQID NO:19
`
`SEQID NO:20
`
`TT
`
`TT
`
`TT
`
`160
`
`120
`
`s so
`3
`
`40
`
`O
`
`40
`
`200
`100
`Time (ms)
`
`300
`
`O
`
`200
`100
`Time (ms)
`
`300
`
`0
`
`200
`100
`Time (ms)
`
`300
`
`Figure 3c
`
`Oxford, Exh. 1014, p. 7
`
`
`
`U.S. Patent
`
`Aug. 30, 2005
`
`Sheet 6 of 18
`
`US 6,936,433 B2
`
`5bp3dT
`
`5bp
`
`100% - - - - - - - - up
`
`62%
`60% -"
`10% --------------------
`
`1000
`
`
`
`100
`
`10
`
`2
`C g
`as
`s
`2
`s
`2
`
`:
`
`:
`
`|
`
`C
`
`100%
`
`529
`10%
`
`1000
`
`100
`
`O
`
`1
`
`2
`
`3.
`
`3.
`
`2
`
`t
`
`O
`
`1
`
`2
`
`3.
`
`1 HIII
`
`-3
`
`-2
`
`-1
`
`o
`
`SWM Score
`
`SVM Score
`
`Figure 4
`
`Oxford, Exh. 1014, p. 8
`
`
`
`U.S. Patent
`
`Aug. 30, 2005
`
`Sheet 7 of 18
`
`US 6,936,433 B2
`
`
`
`100ms
`
`9 be
`bp
`w "-" -
`r
`
`Figure 5
`
`Oxford, Exh. 1014, p. 9
`
`
`
`U.S. Patent
`
`Aug. 30, 2005
`
`Sheet 8 of 18
`
`US 6,936,433 B2
`
`Figure 6.
`
`A) Blunt-ended DNA is attached at one end to a bead.
`
`Bead
`A^ Protected End
`
`Enzyme Accessible End
`
`
`
`SATACGGT. ...GGAATTCGATTATCC 3'
`| |
`|
`|
`|
`| | | |
`| | | |
`|
`W3TArdccA..ccrTAAGetAATAdds'
`
`B) A single nucleotide is cut from the 3 end by a low
`processivity exonuclease such as exonuclease III.
`
`
`
`
`
`
`
`ASATACGGT. GGAATTCGATTATC 3'
`
`3'TATGCCACCTTAAGCTAATAGG 5'
`
`C
`
`C) The single nucleotide overhang at the 5' end is read when the duplex
`end is captured in the nanoscale pore under an applied voltage.
`
`
`
`
`
`A 5ATACGGT....GGAATTCGATTATC 3'
`|
`|
`|
`|
`| |
`|
`| | |
`|
`|
`| |
`73'? ArdccA..ccTTAAGCTAAiAds'
`Nit
`
`D)Once read, the DNA duplex is released from the nanopore by
`reversing the applied voltage.
`
`
`
`A 5'ATACGGT.....GGAATTCGATTATC 3'
`|
`| | | | |
`| |
`| | | | | |
`| ||
`V 3'TATGCCA. CCTTAAGCTAATAGG5"
`
`1N
`
`Nu -
`
`Oxford, Exh. 1014, p. 10
`
`
`
`U.S. Patent
`
`Aug. 30, 2005
`
`Sheet 9 of 18
`
`US 6,936,433 B2
`
`E) The single-nucleotide overhang is then cut with a nuclease (such as
`mung bean exonuclease), resulting in a blunt end.
`
`5ATACGGT.....GGAATTCGATTATC 3'
`
`
`
`3TATGCCA. CCTTAAGCTAATAG 5'
`
`Y G
`
`F) The blunt end is then captured and held in the nanopore by an applied
`voltage. The terminal base-pair is identified while the duplex is
`captured.
`
`
`
`1.N -
`5ATACGGT.... IIST 3'
`| |
`| | |
`| |
`|
`|
`|
`| |
`3TATGCCA... CCTTAAGCTAATA
`
`G)Once read, the DNA duplex is released from the nanopore by
`reversing the applied voltage. The cycle is then repeated at step B).
`
`
`
`1N
`SATACGGT.....GGAATTCGATTATC 3'
`| || --
`|
`|
`| |
`| |
`| | | | |
`3"TATGCCA.....CCTAAGCTAATAG 5'
`
`Oxford, Exh. 1014, p. 11
`
`
`
`U.S. Patent
`
`Aug. 30, 2005
`
`Sheet 10 of 18
`
`US 6,936,433 B2
`
`
`
`-
`EE Acquisition stage:
`-----
`EE ---
`Time-Domain
`Finite State Automaton
`
`" "
`
`
`
`
`
`Strong Positives
`AccuRACY.
`- CLASS
`"SS3%"86t"
`
`
`
`--- 99.9% E ---
`
`opore De
`"Accuracy of Class Identification upon completing 10th
`single noscule sampling classification (approx. 4 seconds).
`
`9A
`
`Figue 7
`
`
`
`Oxford, Exh. 1014, p. 12
`
`
`
`U.S. Patent
`
`Aug
`
`. 30, 2005
`
`Sheet 11 of 18
`
`US 6,936,433 B2
`
`WORD18PUD,¢01Y>]WON3PUD.¢WoyspeorArewug‘ApnysstyyurpasnsuidueyyNGWY31g2L4souanbasIS3SO|9UTSuled-aseqaI)aeasayy,‘xoq&AqpayySpySryave1ogySroujsazwous}1puesed-aseqjeulua)ay“doo,LpAno}@pue‘waysSuo|-11ed-9Seq6BseyUidieYYsey~WYSIa
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`LWAv1d96uveLowwoda6|Loyvodae|we/tidae|vuiidas|voviicae|we/Lidas|viivdgs|vovlodaes|vovLodae
`
`todLLoedlLotLiolidolLotLtottot
`a3]Gal(GaleaGalGaGaGlaivivLVViVolViolViiViiViiVu.vvvvVouYouVLVoiViVi
`ivivivivLy¥iVvivivLvLvLvivivivlviviviviviv9939399939909939399999399
`99999959059999999299999992929299929999909
`0929a939990929350999
`
`
`
`
`
`
`“SINQIISSAUIsK[OWDY—DayyUlponideostwidureyUdAIdBUOYoyeZuruNa10dayyoO}Ayuntxosd
`
`g21nd14
`
`it
`
`Oxford, Exh. 1014, p. 13
`
`Oxford, Exh. 1014, p. 13
`
`
`
`
`
`U.S. Patent
`
`Aug. 30, 2005
`
`Sheet 12 of 18
`
`US 6,936,433 B2
`
`9bpGT/CA
`
`9bpCTIGA
`
`9bpAT/TA
`
`120
`80
`
`40
`
`12
`80
`
`40
`
`12
`
`12
`
`80
`
`40
`
`12
`
`80
`
`40
`
`O
`
`2OO
`
`6OO
`4OO
`milliseconds
`
`800
`
`1 OOO
`
`Figure 9
`
`Oxford, Exh. 1014, p. 14
`
`
`
`U.S. Patent
`
`Aug. 30, 2005
`
`Sheet 13 of 18
`
`US 6,936,433 B2
`
`
`
`0.1
`
`O
`
`1000
`
`Ouration (log ns)
`
`Figure 10
`
`Oxford, Exh. 1014, p. 15
`
`
`
`U.S. Patent
`
`Aug. 30, 2005
`
`Sheet 14 of 18
`
`US 6,936,433 B2
`
`120
`
`
`
`9bp(CT-A)
`
`9bp(-/GA)
`
`9bp(CTIGA)
`
`9bp(TTTA)
`
`80
`
`ac
`9.
`
`-.
`
`Jal
`
`t
`
`s
`
`| W. M. WI-I"- WWW
`
`O
`
`OO
`
`200
`
`300
`
`100
`
`200
`
`300
`
`100
`
`200
`
`300
`
`100
`
`200
`
`300
`
`miliseconds
`
`Figure ll
`
`Oxford, Exh. 1014, p. 16
`
`
`
`U.S. Patent
`
`Aug. 30, 2005
`
`Sheet 15 of 18
`
`US 6,936,433 B2
`
`9bpGT/CA
`9bpTTIAA 'u. = 171 ms
`
`1 2 O
`
`
`
`8 O
`
`40
`
`- 1.0
`
`2.0
`1.0
`O
`Duration (log ms)
`
`3.O
`
`4.O
`
`Figure 12
`
`Oxford, Exh. 1014, p. 17
`
`
`
`U.S. Patent
`
`Aug. 30, 2005
`
`Sheet 16 of 18
`
`US 6,936,433 B2
`
`
`
`120
`
`80
`c
`Cl
`40
`
`O
`O
`
`250
`
`SOO
`
`O
`
`milliseconds
`
`250
`
`500
`
`Figure 13
`
`Oxford, Exh. 1014, p. 18
`
`
`
`U.S. Patent
`
`Aug. 30, 2005
`
`Sheet 17 of 18
`
`US 6,936,433 B2
`
`00
`
`
`
`97
`
`94
`
`9
`
`...
`
`.
`
`85.
`
`32.
`
`79
`
`78
`
`73
`
`70
`
`1.
`
`2
`
`3.
`
`4.
`
`5
`
`9
`s
`7
`s
`Number of Single Molecule Observations
`
`1.
`
`2
`
`3.
`
`4
`
`5
`
`Figure 14
`
`Oxford, Exh. 1014, p. 19
`
`
`
`U.S. Patent
`
`Aug. 30, 2005
`
`Sheet 18 of 18
`
`US 6,936,433 B2
`
`
`
`K. : SS
`
`as
`
`Figure 15.
`
`Oxford, Exh. 1014, p. 20
`
`
`
`15
`
`1
`METHODS AND DEVICES FOR
`CHARACTERIZING DUPLEX NUCLEC
`ACID MOLECULES
`CROSS REFERENCE TO RELATED
`APPLICATIONS
`Pursuant to 35 U.S.C. S 119 (e), this application claims
`priority to the filing date of the U.S. Provisional Patent
`Application Ser. No. 60/253,393 filed Nov. 27, 2000; the
`disclosures of which are herein incorporated by reference.
`ACKNOWLEDGMENT
`This invention was made with United States Government
`support under Contract No. 22401–443720, awarded by the
`Department of Energy; and Grant No. GHO1826, awarded
`by the National Institutes of Health. The United States
`Government has certain rights in this invention.
`INTRODUCTION
`1. Field of the Invention
`The field of this invention is nucleic acid characterization.
`2. Background of the Invention
`A variety of different protocols have been developed for
`characterizing nucleic acids. Such protocols include atomic
`force microScopy, video fluorescence microscopy, and force
`measuring laser tweezers. While the above protocols are
`available, there continues to be a need for the development
`of additional protocols for nucleic acid characterization. Of
`particular interest would be the development of a protocols
`and devices for performing the same which can resolve
`Single nucleotide or Single base-pair differences between
`otherwise identical duplex nucleic acid molecules, e.g.,
`duplex DNA molecules, where the protocols would be rapid
`and capable of automation.
`Relevant Literature
`U.S. patent of interest include: U.S. Pat. Nos. 5,573,905;
`5,723,598 and 6,015,714. In addition, see WO 00/28312.
`Also of interest are Akeson et al., Biophys. J (1999)
`77:3227-3233; Wonderlin et al., Biophys. J. (1990)
`58:289-297; and Kasianowicz, et al., Proc. Natl. Acad. Sci.
`USA (1996) 93: 13770–13773.
`SUMMARY OF THE INVENTION
`Methods and devices are provided for characterizing a
`duplex nucleic acid, e.g., a duplex DNA molecule. In the
`Subject methods, a fluid conducting medium that includes a
`duplex nucleic acid molecule is contacted with a nanopore
`under the influence of an applied electric field and the
`resulting changes in current through the nanopore caused by
`the duplex nucleic acid molecule are monitored. The
`observed changes in current through the nanopore are then
`employed as a set of data values to characterize the duplex
`nucleic acid, where the Set of data values may be employed
`in raw form or manipulated, e.g., into a current blockade
`profile. Also provided are nanopore devices for practicing
`the Subject methods, where the Subject nanopore devices are
`characterized by the presence of an algorithm that directs a
`processing means to employ monitored changes in current
`through a nanopore to characterize a duplex nucleic acid
`molecule responsible for the current changes. The Subject
`methods and devices find use in a variety of applications,
`including, among other applications, the identification of an
`analyte duplex DNA molecule in a Sample and the Sequenc
`ing of duplex DNA molecules.
`BRIEF DESCRIPTION OF THE FIGURES
`65
`FIG.1. Blockade of the O.-hemolysin nanopore by a DNA
`hairpin. The figure shows a current trace caused by capture
`
`45
`
`50
`
`55
`
`60
`
`US 6,936,433 B2
`
`25
`
`35
`
`40
`
`2
`and translocation of a six base-pair DNA hairpin through the
`pore. a, The C-hemolysin heptamer inserted in a lipid
`bilayer. A 120 mV applied Voltage across the open pore
`produces an s 120 pA of ionic current in 1M KCl at room
`temperature.b, Capture of a six base-pair DNA hairpin in the
`channel causes an abrupt current reduction to an intermedi
`ate level (I/I=52% where I is the average event current and
`It is the average open channel current). Because only linear
`Single-Stranded DNA can traverse the 1.5 nm limiting
`aperture, the Stem duplex holds the molecule in the vestibule
`(760 ms median duration). The four deoxythymidines of the
`hairpin loop span the pore entrance, and the Six base pairs of
`the stem extend into the vestibule. Note the increase in low
`frequency noise during hairpin occupancy of the vestibule
`relative to the open channel. c., Translocation of the DNA
`through the limiting aperture of the channel. The partial
`hairpin blockade ends with a sharp downward Spike to
`approximately 14 pa (I/I=12%) that lasts about 60 us. In
`our model, this corresponds to Simultaneous dissociation of
`the Six base pairs in the hairpin stem, which allows trans
`location of the extended strand. The event shown was
`digitally filtered at 10 kHz.
`FIG. 2. Standard free energy of hairpin formation vs
`shoulder blockade duration. Standard free energy of hairpin
`formation was calculated using the mfold DNA server (see
`Table 1), and correlated with median duration of hairpin
`shoulder blockades (Solid circles). Each point represents the
`median blockade duration for a given hairpin length
`acquired using a separate C-hemolysin pore on a separate
`day. Median blockade durations and AG for the equivalent
`of the 6 bp hairpin with a single mismatch (6bp.A., Table 1)
`are represented by open Squares. All experiments were
`conducted in 1.0 M KCl at 22+1° C. with a 120 mV applied
`potential.
`FIG. 3. Discrimination between DNA hairpins at single
`base-pair resolution. a, Event diagram for DNA hairpins
`with 3 to 8 base-pair stems. Events were selected for
`adherence to the shoulder-Spike Signature. Each point rep
`resents the duration and amplitude of a shoulder blockade
`caused by one DNA hairpin captured in the pore vestibule.
`The data for each hairpin are from at least two different
`experiments run on different days. Median I/I values for
`each type of hairpin varied by at most 2%. The duration of
`the 9 bp hairpin blockade shoulders were too long for us to
`record a Statistically significant number of events. Control
`oligonucleotides with the same base compositions as the
`DNA hairpins, but scrambled, caused blockade events that
`were on average much shorter than the hairpin events and
`that did not conform to the shoulder-Spike pattern. b, Clas
`sification of the 6bp hairpin (solid bars) versus all other
`hairpins (open bars) by SVM. Note the log scale on the Y
`axis. The dashed lines mark the limits of the rejection region.
`The boundaries of the rejection region were determined by
`independent data, not post hoc, on the data shown. The
`events that were rejected were primarily fast blockades
`similar to those caused by loops on the dumbbell hairpin
`(Table 1) or acquisition errors caused by the low selectivity
`threshold of the FSA. FIG. 3c provides the structures of
`differing hairpin molecules and their respective current
`blockade profiles.
`FIG. 4. Detection of single nucleotide differences between
`DNA hairpins. a, Comparison of typical current blockade
`Signatures for a 5bp hairpin and a 5bp hairpin with a
`three-dT loop. The standard 5bp hairpin event has a two
`percent deeper blockade than the 5bp3dT hairpin. b, Histo
`gram of SVM scores for 5bp hairpins (filled bars) versus 5bp
`hairpins with three-dT loops (clear bars). c, Comparison of
`
`Oxford, Exh. 1014, p. 21
`
`
`
`25
`
`3
`typical current blockade signatures for a Standard 6bp hair
`pin and a 6bp hairpin with a single dA-dA mismatch in
`the Stem. The 6bp A event is expanded to show the fast
`downward Spikes. These rapid, near-full blockades and the
`much shorter shoulder durations are the main characteristics
`identified and used by SVM to distinguish 6bpA hairpin
`events from 6bp hairpin events. d, Histogram of SVM scores
`for 6bp hairpins (filled bars) versus 6bp A hairpins (clear
`bars).
`FIG. 5. Typical current blockade signatures caused by 7,
`8, and 9 base-pair hairpins obtained using a Voltage pulse
`routine. The top trace represents the Voltage waveform
`applied acroSS a Single C-hemolysin channel. The bottom
`trace represents ionic current through the channel in
`response to this Voltage during a single experiment Sampling
`a mixture of 7, 8, and 9 base-pair hairpins. Each current
`Sweep begins with a capacitance transient followed by a
`Steady current of 122 p.A through the open channel. Capture
`of a hairpin in the pore vestibule (arrows) results in a partial
`blockade. This ends when the voltage briefly reverses to -40
`mV, releasing the hairpin. The blockade events shown for
`each hairpin length are representative of thousands of events
`acquired using a single C-hemolysin pore prepared Sepa
`rately on at least three occasions. All experiments were
`conducted in 1.0 M KCl at 22+1° C. with a 120 mV applied
`potential. The traces shown were acquired at 100 kHz
`bandwidth then filtered at 10 kHz with a digital Gaussian
`filter.
`FIGS. 6A to 6G provide a schematic of a protocol for
`nucleic acid Sequencing employing the Subject methods.
`FIG. 7 provides the Feature Extraction Stage and Feature
`Filter Loop of the HHM analysis that may be employed in
`the Subject invention.
`FIG. 8 provides Table 2 referenced in the experimental
`Section, infra.
`35
`FIG. 9. Blockade of the C-hemolysin pore by 9bp DNA
`hairpins in which the terminal base pair is varied. Blockade
`events were acquired at 120 mV applied potential and 23.0
`C. (See Methods). Each signature shown is caused by a
`Single hairpin molecule captured in the pore vestibule, and
`is representative of Several thousand Single molecule events.
`FIG. 10. Representative blockade of ionic current caused
`by a 9bp DNA hairpin (9bp(GT/CA). Open channel current
`(I) is typically 120 pA at 120 mV and 23.0° C. Here it is
`expressed as 100% current. Capture of a DNA hairpin causes
`a rapid decrease to a residual current I, expressed as a
`percent of the open channel current. Typically, 9bp hairpins
`cause the residual current to transition between four States:
`an upper conductance level (UL), an intermediate level (IL),
`a lower level (LL), and a transient downward spike (S). b)
`A two dimensional plot of log duration VS. amplitude for UL,
`IL, and LL conductance States.
`FIG. 11. Comparison of blockade signatures caused by
`DNA hairpins with dangling and blunt ends. All hairpins
`were built onto a core 8bp DNA hairpin with the primary
`sequence 5'-TTCGAACGTTTTCGTTCGAA-3'.9bp(CT/-
`A) shows a blockade signature caused by a hairpin with a
`dangling 5'-C nucleotide. 9bp(-T/GA) shows a blockade
`Signature caused by a dangling 3'-G nucleotide. 9bp(CT/
`GA) shows a blockade signature for a hairpin in which both
`terminal nucleotides are present forming a 5'-CG-3' termi
`nal Watson-Crick base-pair. 9bp(TT/TA) shows a typical
`blockade signature for a blunt-ended 9bp hairpin in which
`the terminal 5'-TT-3' pair is weakly associated. Experimen
`tal conditions are described under Methods.
`FIG. 12. Dwell time histograms for lower level (LL)
`blockade events. Duration measurements were plotted in
`
`40
`
`45
`
`50
`
`55
`
`60
`
`65
`
`US 6,936,433 B2
`
`15
`
`4
`Semi-log frequency histograms with 20 bins per decade. At
`least 1000 measurements of duration were used for each
`plot. To determine the probability density function and the
`average event lifetime, t, , curves were fit to each histogram
`using the Levenberg-Marquardt method. 9bp(TT/AA) is the
`standard 9bp hairpin with a 5'-TA-3' terminus, and 9bp(GT/
`CA) is a 9bp hairpin with a 5'-GC-3' terminus.
`FIG. 13. Effect of difluorotoluene (F) Substitution for
`thymine (T) on blockades caused by 9bp hairpins. The
`blockade signature at left is caused by a 9bp hairpin with a
`5'-TA-3' terminus (9bp(TT/AA) in Table 1). The blockade
`Signature at right is caused by a nearly identical 9bp hairpin
`in which the 5' thymine is replaced by difluorotoluene
`(9bp(FT/AA) in Table 1) giving a 5'-FA-3' terminus which
`lackS hydrogen bonds. The blockade signatures shown are
`representative of thousands of Single molecule events
`acquired under Standard conditions (see Methods).
`FIG. 14 provides graphical results of experimental data
`reported in the Experimental Section, below.
`FIG. 15. Examination of DNA duplex ends using a
`Voltage-pulse routine. The upper trace represents the Voltage
`across the pore which begins at 0 mV. Applying 120 mV
`(trans Side positive) results in a current increase to 120 pA
`through the open a-hemolysin channel (A in the lower trace
`and in the corresponding diagram). With time, duplex DNA
`is pulled into the pore by the potential causing an abrupt
`current decrease (B). After 300 ms, the potential is reversed
`(-40 mV, trans side), clearing the pore (C). The cycle is then
`repeated to examine the next molecule. The dashed lines at
`the filled and at the open arrows in the lower trace denote the
`beginning and the end of a 100 ms window that is used to
`identify each blockade signature. In the diagrams, the Stick
`figure in blue is a two dimensional Section of the
`a-hemolysin pore derived from X-ray crystallographic data
`(Song et. al.). A ring of lysines that circumscribe a 1.5-nm
`limiting aperture of the channel pore is highlighted in red. A
`ring of threonines that circumscribe the narrowest, 2.3-nm
`diameter Section of the pore mouth is highlighted in green.
`In our working model, the four dT hairpin loop (yellow) is
`perched on this narrow ring of threonines, Suspending the
`duplex Stem in the pore vestibule. The terminal base-pair
`(brown) dangles near the limiting aperture. The structure of
`the 9bp hairpin shown here was rendered to Scale using
`WebLab ViewerPro.
`
`DESCRIPTION OF THE SPECIFIC
`EMBODIMENTS
`Methods and devices are provided for characterizing a
`duplex nucleic acid, e.g., a duplex DNA molecule. In the
`Subject methods, a fluid conducting medium that includes a
`duplex nucleic acid molecule is contacted with a nanopore
`under the influence of an applied electric field and the
`resulting changes in current through the nanopore caused by
`the duplex nucleic acid molecule are monitored. The
`observed changes in current through the nanopore are then
`employed as a set of data values to characterize the duplex
`nucleic acid, where the Set of data values may be employed
`in raw form or manipulated, e.g., into a current blockade
`profile. Also provided are nanopore devices for practicing
`the Subject methods, where the Subject nanopore devices are
`characterized by the presence of an algorithm that directs a
`processing means to employ monitored changes in current
`through a nanopore to characterize a duplex nucleic acid
`molecule responsible for the current changes. The Subject
`methods and devices find use in a variety of applications,
`including, among other applications, the identification of an
`
`Oxford, Exh. 1014, p. 22
`
`
`
`S
`analyte duplex DNA molecule in a Sample and the Sequenc
`ing of duplex DNA molecules.
`Before the subject invention is described further, it is to be
`understood that the invention is not limited to the particular
`embodiments of the invention described below, as variations
`of the particular embodiments may be made and still fall
`within the Scope of the appended claims. It is also to be
`understood that the terminology employed is for the purpose
`of describing particular embodiments, and is not intended to
`be limiting. Instead, the Scope of the present invention will
`be established by the appended claims.
`In this Specification and the appended claims, the Singular
`forms “a,” “an” and “the” include plural reference unless the
`context clearly dictates otherwise. Unless defined otherwise,
`all technical and Scientific terms used herein have the same
`meaning as commonly understood to one of ordinary skill in
`the art to which this invention belongs.
`Where a range of values is provided, it is understood that
`each intervening value, to the tenth of the unit of the lower
`limit unless the context clearly dictates otherwise, between
`the upper and lower limit of that range, and any other Stated
`or intervening value in that Stated range, is encompassed
`within the invention. The upper and lower limits of these
`Smaller ranges may independently be included in the Smaller
`ranges, and are also encompassed within the invention,
`Subject to any Specifically excluded limit in the Stated range.
`Where the stated range includes one or both of the limits,
`ranges excluding either or both of those included limits are
`also included in the invention.
`Unless defined otherwise, all technical and Scientific
`terms used herein have the Same meaning as commonly
`understood to one of ordinary skill in the art to which this
`invention belongs. Although any methods, devices and
`materials similar or equivalent to those described herein can
`be used in the practice or testing of the invention, the
`preferred methods, devices and materials are now described.
`All publications mentioned herein are incorporated herein
`by reference for the purpose of describing and disclosing the
`Subject components of the invention that are described in the
`publications, which components might be used in connec
`tion with the presently described invention.
`Methods
`AS Summarized above, the Subject invention provides
`methods for characterizing double Stranded, i.e., duplex
`nucleic acid molecules. By characterize is meant that the
`Subject invention provides a method of assigning a unique
`description or Signature to a duplex nucleic acid molecule,
`where the unique description/signature may Subsequently be
`employed for a number of a different applications, as
`described in greater detail below. The unique description/
`Signature provided by the Subject methods is made up of
`nanopore current modulation data values generated by the
`duplex nucleic acid upon practice of the Subject methods,
`i.e., one or more current based or derived identifying param
`eters or features which describe the affect of the duplex
`nucleic acid molecule on current through a nanopore under
`the influence of an applied electric field, as described more
`fully below. The Signature assigned to a given duplex
`nucleic acid molecule by the Subject methods may be made
`up of a collection or Set of raw current modulation valueS or
`be made up of processed/manipulated current modulation
`values, e.g., a current blockade profile or portion/specific
`feature(s) thereof, e.g.: shape of profile, duration, I/I, and
`the like.
`The Subject methods are capable of characterizing, i.e.,
`assigning a unique identifying Signature as described above,
`
`15
`
`25
`
`35
`
`40
`
`45
`
`50
`
`55
`
`60
`
`65
`
`US 6,936,433 B2
`
`6
`to a variety of types of duplex nucleic acids, including
`double-stranded DNA molecules, double-stranded RNA
`molecules, double-Stranded nucleic acids that incorporate
`one or more Synthetic or non-naturally occurring
`nucleotides, double-stranded RNA/DNA hybrids, etc. In
`many embodiments, the Subject methods are employed to
`characterize double Stranded DNA molecules, i.e., duplex
`DNA molecules.
`The length of the duplex nucleic acid molecules that may
`be characterized according to the Subject methods may vary
`from short duplex molecules ranging in length from about 2
`to 50, usually from about 4 to 30 and more usually from
`about 4 to 20 bp in length, to much longer molecules, e.g.,
`molecules that exceed 50, 100, 200, 1000, 2000, 5000,
`10000 and even longer bp in length, including whole coding
`regions, whole genes, and even whole chromosomes. In
`many embodiments, the length of the duplex nucleic acid
`molecules that are characterized according to the Subject
`methods range from about 3 to 100,000, usually from about
`6 to 10,000 and more usually from about 6 to 1,000 bp.
`A feature of the Subject invention is that a nanopore
`device is employed to characterize the duplex nucleic acid,
`i.e., assign a unique identifying Signature based on measured
`modulations in current through a nanopore. Specifically, the
`duplex nucleic acid is contacted with a nanopore present in
`a device under the influence of an applied electric field and
`the effect over time on a measurable Signal through the
`nanopore is observed and employed to characterize or assign
`an identifying Signature to the duplex nucleic acid, where the
`Signature may take a number of different forms, e.g., a
`collection of raw data values, a manipulated Set of data
`values such as is found in a current blockade profile, and the
`like.
`The nanopore device that is employed in the Subject
`methods is typically a device that comprises a nanopore
`inserted into a thin film with means for applying an electric
`field acroSS the nanopore and for measuring the resultant
`Signal at the nanopore. By nanopore is meant a structure
`having a channel or pore with a diameter of "nano'
`dimensions, where the inner diameter of the pore or channel
`typically ranges from about 1 to 10, usually from about 1 to
`5 and more usually from about 1 to 2 nm. The nanopore may
`be Synthetic or naturally occurring, where naturally occur
`ring nanopores include oligomeric protein channels, Such as
`porins, gramicidins, and Synthetic peptides and the like,
`where a particularly preferred protein channel is the Self
`assembled heptameric channel of C-hemolysin. In one
`embodiment, the thin film into which the nanopore is
`inserted is a lipid bilayer fabricated from a wide variety of
`one or more different lipids, where suitable lipids include:
`phosphatidly cho line,
`phosphatidyl Serine,
`phosphatidylethanolamine, glycerol mono-oleate, and cho
`lesterol.
`A variety of Suitable thin film support devices have been
`reported in the literature that may be used to Support the
`nanopore used to detect the molecular bar code. Such
`devices include those described in: Brutyan et al., Bio
`chimica et Biophysica Acta (1995) 1236:339–344; Wonder
`lin et al., Biophys.J. (1990) 58:289-297; Suarez-Isla et al.
`Biochemistry (1983) 22:2319-2323 as well as those dis
`closed and reviewed in U.S. Pat. No. 6,015,714; the disclo
`Sure of which is herein incorporated by reference.
`Of particular interest is the device described in WO
`00/28312 and its corresponding U.S. application Ser. No.
`09/.430,240, the disclosure of which is herein incorporated
`by reference. In these embodiments, the Subject Single
`channel thin film devices include the following elements: (a)
`
`Oxford, Exh. 1014, p. 23
`
`
`
`US 6,936,433 B2
`
`15
`
`25
`
`7
`a cis chamber; (b) a trans chamber; (c) an electrical com
`munication means connecting the cis and trans chambers,
`and (d) a thin film at the cis terminus of the electrical
`communication means that contains a single nanopore or
`channel.
`The cis and trans chambers may have any convenient
`configuration. AS Such, the cis and trans chambers may have
`a conical, cylindrical, cube, or other shape as desired. The
`volume of the chambers may vary as well, where the volume
`of each chamber is at least about 1 ul, usually at least about
`10 ul and more usually at least about 50 ul, and may be as
`large as 1 ml or larger, but will usually not exceed about 2
`ml and more usually will not exceed about 10 ml. In certain
`preferred emb