`Gupte et al.
`
`54 METHOD FOR SEQUENCING BOTH
`STRANDS OF A DOUBLE STRANDED DNA
`IN A SINGLE SEQUENCING REACTION
`75 Inventors: Jamila Gupte, Layton; Arnold
`Oliphant, Erda, both of Utah
`73 Assignee: Myriad Genetics, Inc., Salt Lake City,
`Utah
`
`21 Appl. No.: 08/925,277
`22 Filed:
`Sep. 8, 1997
`51) Int. Cl." ............................. C12P 1934; CO7H 21/04
`52 U.S. Cl. ............................ 435/6; 435/912; 536/24.3;
`536/24.33; 536/26.6
`58 Field of Search ................................ 536/24.33, 24.3,
`536/26.6; 435/91.2, 6
`
`56)
`
`References Cited
`
`U.S. PATENT DOCUMENTS
`
`5,411,875 5/1995 Jones ...................................... 435/91.2
`OTHER PUBLICATIONS
`Chadwick, RB, Conrad, MP, McGinnis, MD, Johnston Dow,
`L., Spurgeon, SL and Kronick, MN (1996). “Heterozygote
`and Mutation Detection by Direct Automated Fluorescent
`DNA Sequencing Using a Mutant Taq DNA Polymerase”,
`BioTechniques 20:676-683.
`Choi, TJ, Wagner, JD and Jackson, AO (1994). “Sequence
`Analysis of the Trailer Region of Sonchus Yellow Net Virus
`Genomic RNA”, Virology 202:33–40.
`Jones, DH (1995). “Panhandle PCR”, PCR Methods and
`Applications 4:S195-S201.
`Jones, DH and Winistorfer, SC (1992). “Sequence specific
`generation of a DNA panhandle permits OCR amplification
`of unknown flanking DNA, Nucleic Acids Research
`20:595-600.
`Jones, DH and Winistorfer, SC (1993). “Genome Walking
`with 2-to 4-kb Steps. Using Panhandle PCR", PCR Methods
`and Applications 2:197-203.
`
`US006087099A
`Patent Number:
`11
`(45) Date of Patent:
`
`6,087,099
`Jul. 11, 2000
`
`Ju, J., Ruan, C., Fuller, CW, Glazer, AN and Mathies, RA
`(1995). “Fluorescence energy transfer dye-labeled primers
`for DNA sequencing and analysis”, Proc. Natl. Acad. Sci.
`USA 92:4347-4351.
`Wetzel, T., Dietzgen, RG and Dale, JL (1994). “Genomic
`Organization of Lettuce Necrotic Yellows Rhabdovirus',
`Virology 200:401–412.
`
`Primary Examiner Ardin H. Marschel
`ASSistant Examiner Joyce Tung
`Attorney, Agent, or Firm-Rothwell, Figg, Ernst & Kurz PC
`57
`ABSTRACT
`A method is presented which uses a unique opposite Strand
`joining Strategy during PCR of an original DNA to generate
`a product which, when Sequenced with a Single Sequencing
`primer yields the Sequence of both Strands of the original
`DNA. The PCR primers include 1) a modified oligomer
`corresponding to the 5' end of a first strand of the DNA to
`be amplified wherein Said modified oligomer includes the
`reverse complementary Sequence to a Sequence within Said
`first strand of DNA and a specific PCR priming sequence
`which will specifically hybridize to a portion of the DNA to
`be amplified and 2) a second oligomer corresponding to the
`5' end of the second strand of the DNA to be amplified and
`which contains the priming Sequence for the Second Strand
`of the DNA and will specifically hybridize to a portion of the
`DNA to be amplified. During PCR an intermediate product
`is formed where one end of one Strand loops around to
`hybridize to its complement on the same Strand. This results
`in a hairpin Structure which elongates using its own Strand
`as a template to form a double sized product that contains the
`Sequence of both original Strands. Upon denaturation this
`yields Single Strands with the Single Strands having the
`Sequence of both of the original Strands included in tandem.
`Sequencing these Single Strands using a single primer, e.g.,
`a primer complementary to the Second oligomer, yields the
`sequences of both strands of the DNA of interest.
`
`6 Claims, 3 Drawing Sheets
`
`1985'AGGAAACAGCTATGACCATTGATCCTCATTATCATGGAAAATTTGT 3 SEC ID NO:1
`- - - - - - - -R13R'- - - - - - - -|- - - - - - - - - - - - G2' - - - - - - - - - - - -
`
`19F, 5 GTTTTCCCAGTCACGACGTCATTCTTCCTGGCTCTTTTGT 3 SEC ID NO2
`F - - - - - - - -3F- - - - - - - - - - - - - - - - G----------
`
`19XF,5' CAGCGATTCGCATTCTTCCTGTGCTCTTTTGT 3' SEC ID NO:3
`- - - -C- - - - - - - - - - - - - G1- - - - - - - - - - -
`
`5' ... tcc totGICATCTTCCTGTGCTCTTTTGGAATCGCTGacctCt. 3'SEC ID NO:4
`- - - - - - - - - - - - G----------- - - - - C - - - -
`
`Oxford, Exh. 1005, p. 1
`
`
`
`U.S. Patent
`
`Jul. 11, 2000
`
`Sheet 1 of 3
`
`6,087,099
`
`19R,5'AGGAAACAGCTATGACCATTGATCCTCATTATCATGGAAAATTTGT 3' SEQ ID NO:1
`- - - - - - - -M13R'- - - - - - - - - - - - - - - - - - - - G2' - - - - - - - - - - - -
`
`FIG. 1A
`
`19F, 5 GTTTTCCCAGTCACGACGGTCATTCTTCCTGTGCTCTTTTGT 3 SEC ID NO: 2
`- - - - - - - - -M13F - - - - - - - - - - - - - - - - G1- - - - - - - - - -
`
`FIG. 1B
`
`19XF, 5 CAGCGATTCGTCATTCTTCCTGTGCTCTTTTGT 3 SEQ ID NO:3
`----C - - - - - - - - - - - - - G1- - - - - - - - - - -
`
`FIG. 1C
`
`5 . . . tcc totGTCATTCTTCCTGTGCTCTTTTGTGAATCGCTGacctCt... 3'SEQ ID NO: 4
`- - - - - - - - - - - - - G1 - - - - - - - - - - - - - - - C - - - -
`
`FIG. 1D
`
`Oxford, Exh. 1005, p. 2
`
`
`
`U.S. Patent
`
`Jul. 11, 2000
`
`Sheet 2 of 3
`
`6,087,099
`
`EXON19 G2
`G1C
`Stl. eeedit a . 3"
`3hoors-TTT 3!
`G1'C' EXON19' G2'
`y
`FIG. 2A
`
`PCR WITH 19XF AND 19R
`
`C'G1C EXON19 G2 M13R
`
`C GL'C'EXON19'G2'M13R'
`
`FIG. 2B
`3° END TURN AROUND
`
`G1
`
`C 3:
`
`5!
`C' EXONL9' G2'M13R'
`
`' ELONGATION
`FIG. 2C
`
`(G1 OR G1') GL!
`
`C pxon19 G2 M13R 3' OSEQ.
`5!
`c' EXON19' G2’ M13R'
`AL
`FIG. 2D
`
`DENATURE, ANNEAL
`DENATURE, ANNEAL
`19R & ELONGATE
`19XF & ELONGATE
`
`M13R'G2 'EXON19'C'G1'C EXON19 G2 M13R
`Bt 38 SEO.
`SEQ.O3!8Sqtot SC
`M13
`G2 EXON19 CG1 C' EXON19'G2 'M13R'
`°
`FIG. 2E
`
`“a
`eeeeSPANeRG2'EXON19'C'G1'C sontG2M13
`
`SEQ.03° TTTTTooo
`
`M13 G2 EXON19C G1C'
`R
`
`FIG. 2F
`
`Oxford, Exh. 1005, p. 3
`
`Oxford, Exh. 1005, p. 3
`
`
`
`U.S. Patent
`
`Jul. 11, 2000
`
`Sheet 3 of 3
`
`6,087,099
`
`All FIG. 3A
`
`
`
`Oxford, Exh. 1005, p. 4
`
`
`
`6,087,099
`
`15
`
`25
`
`1
`METHOD FOR SEQUENCING BOTH
`STRANDS OF A DOUBLE STRANDED DNA
`IN A SINGLE SEQUENCING REACTION
`BACKGROUND OF THE INVENTION
`Sequencing of nucleic acids is an extremely important and
`widely used technique. It is used for a variety of purposes.
`One such purpose is to identify whether mutations within
`genes of known Sequence are present in a Sample of DNA
`taken from a perSon. This is especially important in diag
`nosing whether the person may have a disease which is
`known to be associated with Specific mutations in the gene
`being analyzed. When this type of testing is performed, it is
`common to Sequence both Strands of DNA to minimize any
`errors which may occur in the Sequencing. To date, when
`Sequencing both Strands by the Sanger dideoxy method there
`has been a requirement to use one primer to Sequence the
`Sense Strand and a Second primer to Sequence the antisense
`strand of the double-stranded DNA. The two strands have
`been Sequenced in Separate Sets of reactions. The present
`invention is a technique by which both strands of DNA are
`Sequenced in a single Set of reactions using only a single
`primer. This method allows one to use fewer reactions for
`obtaining the data. This is especially important for labora
`tories which will be processing many Samples. The use of
`fewer reactions will decrease the cost of analysis.
`DNA sequencing methods were developed during the
`1970s by Maxam and Gilbert (1977) and by Sanger (1977).
`The Sanger method which uses dideoxy nucleotides to
`terminate newly synthesized DNA strands is most com
`monly used and has been adapted Such that it can be used
`with fluorescent markers rather than radioactivity. One
`variation is a technique called cycle Sequencing in which
`DNA sequencing is combined with polymerase chain reac
`tion (PCR). Chadwicket al. (1996) teach a variation of cycle
`Sequencing in which a mutant Taq DNA polymerase is
`utilized.
`The polymerase chain reaction itself is only one of a
`number of different methods now available for amplifying
`nucleic acids. Some of the other methods include ligase
`chain reaction (Wu and Wallace, 1989), Strand Displace
`ment Amplification (SDA) (Walker, U.S. Pat. No. 5,455,166
`(1995); Walker et al., 1992), thermophilic SDA (Spargo et
`al., 1996), and 3SR or NASBA(Compton, 1991; Fahy et al.,
`1991).
`The instant invention is a method of using a specially
`designed oligomer which contains a reverse complement
`Sequence along with a Standard primer during PCR. This
`generates a double stranded DNA product such that when it
`50
`is denatured one end of the resulting Single Stranded DNA
`loops around to form an intrastrand Stem-loop Structure. This
`Structure is then elongated thereby producing a double
`stranded DNA but wherein the two strands are joined by a
`loop. This method is referred to as opposite Strand joining
`PCR. When denatured this product forms a single-stranded
`DNA which contains both strands of the original DNA.
`When this resulting single-stranded DNA is sequenced it
`yields the Sequence of both Strands of the original double
`stranded DNA.
`A similar Stem-loop DNA structure was used as a template
`for PCR amplification by Jones et al. (1992). The Jones et al.
`reference describes a "panhandle PCR' method. This tech
`nique introduced a Self-complementary portion into the
`target DNA strand by ligation. The goal of panhandle PCR
`is to amplify unknown Sequence by generating a Stem loop
`template structure for PCR whereas one of the goals of
`
`2
`opposite Strand joining PCR is to amplify known Sequence
`by generating a stem-loop Structure during PCR and then
`Sequencing both Strands of the longer product in one
`Sequencing reaction. Another use for opposite Strandjoining
`PCR is in denaturing gradient gel electrophoresis techniques
`wherein the use of this technique can form a covalently
`bonded hairpin loop which can replace the use of a GC
`clamp. Yet another use for opposite Strand joining PCR is
`simply the use of the method effectively to join together the
`two strands of any double stranded DNA into a single strand
`of DNA for any desired purpose.
`SUMMARY OF THE INVENTION
`A method is presented which uses a unique opposite
`Strand joining Strategy during PCR of an original DNA to
`generate a product which, when Sequenced with a single
`Sequencing primer yields the Sequence of both Strands of the
`original DNA. The PCR primers include 1) a modified
`oligomer corresponding to the 5' end of a first Strand of the
`DNA to be amplified wherein said modified oligomer
`includes the reverse complementary Sequence to a sequence
`within said first strand of DNA and a specific PCR priming
`Sequence which will specifically hybridize to a portion of the
`DNA to be amplified and 2) a Second oligomer correspond
`ing to the 5' end of the second strand of the DNA to be
`amplified and which contains the priming Sequence for the
`second strand of the DNA and will specifically hybridize to
`a portion of the DNA to be amplified. During PCR an
`intermediate product is formed where one end of one Strand
`loops around to hybridize to its complement on the same
`Strand. This results in a hairpin Structure which elongates
`using its own Strand as a template to form a double sized
`product that contains the Sequence of both original Strands.
`Upon denaturation this yields a single Strand having the
`Sequence of both of the original Strands included in tandem.
`Sequencing these Single Strands using a single primer, e.g.,
`a primer complementary to the Second oligomer, yields the
`sequences of both strands of the DNA of interest.
`BRIEF DESCRIPTION OF THE DRAWINGS
`FIGS. 1A-1D show the primer design used in the
`Example. FIG. 1A shows the sequence of primer 19R which
`consists of the -28M13 reverse DET primer sequence
`(shown in bold) which is 5' to the gene specific sequence
`G2". FIG. 1B shows the sequence of primer 19F which
`consists of the -40M13 forward DET sequence (shown in
`bold) which is 5' to the gene specific sequence G1. FIG. 1C
`shows the Sequence of the opposite Strand joining primer
`19XF which consists of a short reverse complemented
`genomic sequence C" (shown in bold) which is 5' to the gene
`specific sequence G1 used in primer 19F. FIG. 1D shows the
`genomic Sequence in the region of the opposite Strand
`joining primer. The gene specific sequence G1 (shown in
`nonbolded upper case letters) used in both the 19F and 19XF
`primers is 5' of Sequence C (shown in bold upper case
`letters). It is this genomic region C which is reverse comple
`mented (and therefore called C) and placed 5' to the gene
`Specific Sequence G1 in the opposite Strand joining primer
`19XF.
`FIGS. 2A-2F illustrate the opposite strand joining strat
`egy. Throughout these figures, all the strands labeled SEQ
`are Substrates for dye primer Sequencing.
`FIG. 2A shows genomic DNA in the region of exon 19.
`This is shown as four Sections on each Strand with one Strand
`having G1, C, the exon 19 containing region, and G2 and the
`opposite Strand being designated with primes, e.g., G1', C.,
`
`35
`
`40
`
`45
`
`55
`
`60
`
`65
`
`Oxford, Exh. 1005, p. 5
`
`
`
`6,087,099
`
`15
`
`3
`etc. Region C is the portion which is complementary to a
`portion of primer 19XF and which will hybridize with the
`appended primer So that there is intrastrand hybridization
`forming a loop and a double-stranded region of DNA. The
`eXOn 19 region is the region of interest to be sequenced.
`5
`FIG. 2B shows the product obtained when the DNA
`shown in FIG. 2A is subjected to PCR with primers 19XF
`and 19R. The major amplified product is similar to the DNA
`of FIG. 2A but has had a C/C tail added at one end and an
`M13R/M13R' tail added at the other end.
`FIG. 2C shows the exon 19' strand of FIG.2B following
`denaturation. This illustrates that intrastrand binding occurs
`forming a loop with the C tail hybridizing to the C" portion
`of the strand. This product is a substrate for dye terminator
`Sequencing in the absence of primer.
`FIG. 2D illustrates the product formed after elongating
`the DNA shown in FIG. 2C. The product, which upon
`denaturation is a single-Stranded molecule, contains both
`strands of exon 19, i.e., it contains both exon 19 and exon 19
`in a tandem arrangement (separated by C, G1' and C).
`FIG. 2E illustrates the product formed when the DNA of
`FIG. 2D undergoes another cycle of PCR using primer 19R.
`Note that the DNA shown in FIG. 2E is palindromic except
`for the very central G1/G1' region and Sequencing both
`Strands yields the identical Sequence except for the G1/G1
`region (which is not of interest). G1 and G1' are comple
`mentary and are of equal length and therefore the Sequence
`obtained from both Strands using a single primer is identical
`throughout except for the central G1/G1' section which will
`not interfere with the reading of the rest of the Sequence. The
`fill length products formed and shown in FIG. 2E can then
`be used in further rounds of PCR using primer 19R.
`FIG. 2F illustrates the products formed when the DNA of
`FIG. 2D undergoes another cycle of PCR using primers
`19XF and 19R. The product shown is a result of primer
`19XF priming this cycle on the FIG. 2D DNA. Each strand
`of this product can reenter the cycle of steps at Step A (short
`Strand) or step D (long Strand).
`FIGS. 3A-3D show the sequence comparison of both
`strands of the BRCA1 exon 19 obtained from a single
`Sequencing lane.
`FIG. 3A shows the sequence of exon 19" of the products
`B, D, E and F (shown in FIG. 2) amplified by the primers
`19XF and 19R for which sequencing the -28M13 reverse
`primer was used.
`FIG. 3B shows the sequence of exon 19 of the products
`B, D, E and F (shown in FIG. 2) amplified by the primers
`19XF and 19R for which sequencing the -28M13 reverse
`primer was used.
`FIG. 3C shows the sequence of exon 19" of the product
`amplified by the standard primers 19F and 19R gene for
`which Sequencing the -28M13 reverse primer was used.
`FIG. 3D shows the sequence of exon 19 of the product
`amplified by the standard primers 19F and 19R for which
`Sequencing the -40M13 forward primer was used.
`DESCRIPTION OF THE INVENTION
`The present invention is directed to Sequencing both
`strands of a double-stranded DNA molecule by using only a
`Single Set of labeled primerS rather than using two sets of
`labeled primers as is done conventionally. The ability to
`Sequence both Strands using a Single Set of reactions is more
`efficient and less expensive. The method is especially appro
`priate for Sequencing both Strands of Shorter pieces of DNA
`such that one strand of a DNA of double length could be
`65
`Sequenced in a single Sequencing run by conventional meth
`ods.
`
`35
`
`40
`
`45
`
`4
`The present invention is also especially Suitable for use in
`clinical laboratories which will be sequencing large numbers
`of Samples of genes of known Sequence to determine
`whether the Samples contain mutations. AS an example, a
`diagnostic test for breast cancer (BRACAnalysisTM)
`involves complete PCR and Sequencing of the coding
`Sequences and proximal introns of both alleles of a patient's
`BRCA1 and BRCA2 genes in order to find any deleterious
`mutations. To ensure high quality and consistency, the
`diagnostic test is completely automated. A total of 35
`amplicons for BRCA1 and 47 amplicons for BRCA2 are
`Sequenced. The PCR products Sequenced during the Stan
`dard BRACAnalysisTM are amplified with 5' M13 tailed
`gene Specific primers. Following amplification, the products
`contain the M13 tail Sequences at their ends. During
`Sequencing both Strands of the amplified products are
`Sequenced in two separate reactions. The Sequencing reac
`tions are ethanol precipitated and resolved in two Separate
`lanes on an Applied BioSystems 377 Sequencing gel. The
`Sequences obtained are analyzed for the presence of muta
`tions and polymorphisms.
`The instant invention involves a novel concept to
`Sequence both Strands of the amplified products in one
`Sequencing reaction. The Sequence obtained for both the
`DNA Strands is present in a Single lane of a Sequencing gel.
`The Example below, which is not intended to limit the
`invention in any manner, describes use of this method for
`exon 19 in the BRCA1 gene. The tailed genomic primer 19R
`(see FIG. 1), developed for the standard BRACAnalysisTM
`test, in combination with the unique opposite Strand joining
`primer 19XF is used for PCR. During PCR an intermediate
`turnaround strand is formed where the 3' end loops around
`and hybridizes to a complementary region on the same
`Strand thus generating a stem loop Structure. Elongation of
`this stem loop structure at the 3' end results in the formation
`of a longer product which contains the Sequence of both
`Strands. In a complex multiamplicon test Such as
`BRACAnalysisTM, application of this technique to each
`suitable amplicon will substantially reduce the number of
`Sequencing reactions and the number of Sequencing gel
`lanes used, making the test more cost efficient.
`The method disclosed here is designated “opposite Strand
`joining PCR'. It uses an opposite Strand joining primer
`during PCR to generate a turnaround structure resulting in
`the formation of a double size DNA strand (FIGS. 2C and
`2D). Combination of the opposite Strand joining primer
`(19XF in FIG. 1C) and the 19R primer (FIG. 1A) was used
`during PCR. PCR with these two primers results in the
`formation of a double-Stranded intermediate product of
`which one of the strands containing the M13 tail at the 3' end
`can be sequenced using the -28M13 reverse Sequencing
`primer (FIG. 2B). The 3' end of the other strand can turn
`around to form a stem loop Structure by intra-Strand anneal
`ing where the 3' end hybridizes to the complementary
`sequence on the same strand (FIG.2C). This 3' end can then
`be used as a primer for the same Strand and elongate to form
`the double size product (FIG. 2D). During the next PCR
`cycle, this longer product denatures and anneals with the
`19XF and 19R primers which elongate. This results in the
`formation of products as shown in FIGS. 2E and 2F. These
`products are templates for primer annealing and elongation
`during the next PCR cycles.
`To verify the formation of the turnaround intermediate
`Structure in FIG. 2C, dye terminator Sequencing was per
`formed for the products amplified by the primers 19XF and
`19R. The turned around 3' end (FIG.2C) acts as a primer and
`elongates using the same Strand as a template during dye
`
`25
`
`50
`
`55
`
`60
`
`Oxford, Exh. 1005, p. 6
`
`
`
`6,087,099
`
`25
`
`35
`
`15
`
`S
`terminator Sequencing. Sequence of only one Strand was
`observed by dye terminator Sequencing (data not shown).
`Thus, PCR amplification with an opposite Strand joining
`primer enables dye terminator Sequencing to be carried out
`without a primer.
`The technique of opposite strandjoining PCR is useful for
`modifying denaturing gradient gel electrophoresis (DGGE),
`a technique used for mutation Screening. Single base
`changes in the DNA have been detected by DGGE using a
`GC clamp attached to one end of the amplified product
`(Fischer et al., 1983; Myers et al., 1985a; Myers et al.,
`1985b). Addition of a GC clamp at the end of the PCR
`product using a modified primer creates a high melting
`temperature region making it possible to detect base changes
`in the rest of the strand. The GC clamp can be replaced by
`a covalently bonded hairpin loop by designing an opposite
`Strand joining primer. The region of interest is amplified
`using the combination of the opposite Strand joining primer
`designed at one end and a conventional primer at the other
`end of the region.
`Definitions
`A“primer' is an oligomer which will hybridize to a strand
`of nucleic acid and which can be extended or elongated by
`the addition of nucleotides to form a nucleic acid Strand of
`complementary Sequence to the Strand of nucleic acid to
`which the primer is hybridized. One example of such a
`reaction is the polymerase chain reaction in which two
`primers are used wherein one primer is complementary to
`the 5' end of nucleic acid to be amplified and a Second primer
`is complementary to the 3' end of nucleic acid to be
`amplified and further wherein one primer is complementary
`to the Sense Strand and the other primer is complementary to
`the antisense Strand. Another example is a Sequencing reac
`tion wherein the DNA to be Sequenced is made Single
`Stranded and a primer is added which primer is complemen
`tary to a portion of one of the single strands of DNA and is
`elongated.
`A “single primer’ means a primer comprising a single
`nucleotide Sequence. The phrase “single primer' may
`encompass more than only one primer. It encompasses, e.g.,
`four distinct primers which all have identical nucleotide
`Sequences but which are labeled with four distinct markers
`Such as four different fluors wherein each primer molecule
`comprises one of the four fluors. Each of these four primers
`may be used Separately in Sequencing reactions, yet they are
`together considered to be a Single primer. Alternatively, a
`Single primer may in fact represent only one primer which
`is identical in all cases, Such as will occur when Sequencing
`using a radioactively labeled primer or radioactively labeled
`dNTPs or when performing dye terminator Sequencing, but
`the definition is not So limited for purposes of the present
`disclosure.
`A “single Set of Sequencing reactions' refers to the
`reactions necessary to Sequence a Single Strand of DNA.
`Commonly a Single Set of Sequencing reactions will consist
`of four Separate reactions which later are either run on four
`lanes of a gel if a radioactive label is used or are mixed
`together and run on a single lane of a gel if fluorescent labels
`are used.
`A "reverse complementary Sequence of nucleotides'
`60
`refers to a sequence of nucleotides within a strand of DNA
`which is complementary to another Sequence of nucleotides
`within the same strand of DNA but in the reverse order Such
`that when the Single Strand folds back upon itself the reverse
`complementary Sequence of nucleotides can hybridize to its
`complementary Sequence within the same Strand thereby
`yielding a hairpin Structure.
`
`6
`“Effectively to join' together two strands of a double
`stranded DNA into a single-stranded DNA means to use a
`method which does not actually join the two existing Strands
`of double-stranded DNA together but which has the same
`effect as so doing for a portion of the double-stranded DNA.
`The original double-stranded DNA is amplified and the
`newly formed DNA undergoes Steps to yield a single
`Stranded DNA which includes the Same Sequences as found
`in the two Strands of a portion of the amplified region of the
`double-stranded DNA. The result is that, although the two
`strands of the original double-stranded DNA are not them
`Selves joined together, the effect is the same as having done
`so for a portion of the original double-stranded DNA.
`EXAMPLE
`
`A. Primer Design
`The primers 19F and 19R (see FIGS. 1A and 1B) are the
`primers for exon 19 of the BRCA1 gene used in the standard
`BRACAnalysisTM diagnostic assay. These primers contain
`the gene specific region and the -40M13 forward or
`-28M13 reverse DYEnamic energy transfer (DET) primer
`Sequence from Amersham Life Science at its 5' end.
`The opposite strand joining primer, 19XF (FIG. 1C), for
`exon 19 was designed as follows. This primer contains the
`Same gene Specific Sequence G1 as the 19F primer but the
`Sequence at the 5' end contains a 9 basepair reverse comple
`mented genomic sequence (C). The genomic sequence C
`which corresponds to C' is present 3' to the 19F gene specific
`sequence G1 in the genomic DNA (FIG. 1D and FIG. 2A).
`B. Polymerase Chain Reaction
`Human genomic DNA was amplified by PCR using the
`primer 19R in combination with either primer 19F (for the
`linear product) or 19XF (for the turnaround product). The
`reactions were carried out in a total volume of 9 till and
`contained 20 ng DNA, 0.2 mM each dNTP, 0.5 units
`Amplitaq Gold DNA polymerase (from Perkin-Elmer), 10
`mM Tris pH8.3, 50 mM KCl, 1 mM EDTA, 6.5 mM MgCl,
`10% sucrose and 0.01% Tween 20, 0.1 uM of primer 19R
`and either 0.1 uM of primer 19F or 0.4 uM primer 19XF,
`respectively. The reactions were layered with oil and then
`cycled in the DNA Engine Thermal cycler at 94 C. for 10
`minutes followed by 36 cycles of 96° C. for 20 seconds, 62
`C. for 30 seconds and 72 C. for 60 seconds. This was
`followed by 1 cycle at 72 C. for 60 seconds.
`C. Sequencing
`Dye primer Sequencing reactions were carried out with
`half volume of 1:10 diluted PCR products, 0.2 uM
`dideoxynucleotide/45uM deoxynucleotide mix, 80 mM Tris
`pH 9.5, 2% sucrose, 0.05% Triton X, 1 mM EDTA, 5 mM
`MgSO, 0.075 units Taq FS polymerase (Kalman et al.,
`1995; Tabor et al., 1995) and 0.04 uM-40M13 forward or
`-28M13 reverse DET primers (Ju et al., 1995a; Ju et al.,
`1995b). The reactions were layered with oil and then cycled
`in the DNA Engine Thermal cycler for 32 cycles at 96° C.
`for 20 seconds, 56° C. for 30 seconds and 72 C. for 60
`seconds, followed by one cycle at 72 C. for 60 seconds.
`The product amplified by the primers 19F and 19R was
`sequenced in both directions using the -40M13 forward and
`the -28M13 reverse Sequencing primers. The products cre
`ated by the primers 19XF and 19R were sequenced using the
`-28M13 reverse sequencing primer. The four forward (or
`reverse) reactions were pooled and ethanol precipitated. The
`precipitate was resuspended in 50% formamide, 50 mM
`EDTA, denatured and loaded on an Applied Biosystems 377
`Sequencing gel.
`D. Results
`FIGS. 2A-2F illustrate opposite strand joining PCR for
`exon 19 of BRCA1 where one strand of the double stranded
`
`40
`
`45
`
`50
`
`55
`
`65
`
`Oxford, Exh. 1005, p. 7
`
`
`
`7
`product shown in FIG. 2B, the turnaround product shown in
`FIG. 2D and both strands of the products shown in FIGS. 2E
`and 2F are Substrates for dye primer Sequencing using the
`-28M13 reverse sequencing primer. The two strands of exon
`19 (strands 19 and 19") are present on two different strands
`in the genomic DNA (FIG. 2A). When genomic DNA is
`amplified in the conventional manner using primerS 19F and
`19R, a double-stranded product is generated in which one
`Strand contains the exon 19 Strand and the opposite Strand
`contains the exon 19' strand. In contrast to this conventional
`result, opposite Strand joining PCR generates products
`shown in FIGS. 2D and 2E in which the original exon 19 and
`exon 19' strands are both contained within a single strand of
`DNA. The longer strand of the product shown in FIG. 2F
`also contains both the exon 19 and exon 19' strands. The
`sequence of exon 19 and exon 19" in these products can be
`obtained by using only one Sequencing primer Since the 19R
`primer has the -28M 13 sequence at its 5' end whereas the
`19XF primer has no M13 tail.
`FIG. 3 illustrates the sequences obtained from the prod
`ucts amplified by the primer combinations 19F with 19R
`(standard PCR) and 19XF with 19R (opposite strandjoining
`PCR). Electropherograms A and B (FIGS. 3A and 3B)
`represent the Sequence in both directions for the products
`(FIGS. 2B, 2D, 2E and 2F) amplified by the primers 19XF
`and 19R and sequenced with the -28M 13 reverse primer in
`a single reaction and in a single lane on a Sequencing gel.
`Electropherograms C and D (FIGS. 3C and 3D) represent
`the Sequence of the two Strands for the product amplified by
`the primers 19F and 19R and sequenced with the -40M13
`forward or the -28M13 reverse primer in two separate
`reactions and in two lanes on a Sequencing gel. Comparison
`of the electropherograms A and C shows the same sequence
`for the products generated by primers 19XF with 19R and
`for the product generated by the primers 19F with 19R
`Sequenced by the Same Sequencing primer. Comparison of
`the electropherograms B and D shows the same Sequence for
`the products generated by primers 19XF with 19R and for
`the product generated by primers 19F with 19R but
`Sequenced by two different Sequencing primers. Thus, from
`electropherograms A and B, the Sequence of eXOn 19 of the
`BRCA1 gene can be read in both directions from a single Set
`of Sequencing reactions using only one Sequencing primer.
`In tests to optimize the above method of opposite Strand
`joining PCR, various concentrations (0.0125uM, 0.025uM,
`0.05uM, 0.1 uM, 0.2 uM and 0.4 uM) of the opposite strand
`joining primer, 19XF, in combination with various lengths
`(20 bases, 14 bases, 10 bases, 9 bases, 8 bases and 6 bases)
`of the 5' reverse complemented Sequence while keeping the
`concentration of the primer 19R at 0.1 uM. Equal sequence
`Signal intensity values for both directions in the turnaround
`product were seen when the length of the 5' reverse comple
`mented sequence in the 19XF primer was 9 bases and the
`concentration was 0.4 uM.
`Those of skill in the art will realize that the Example is
`only illustrative and that many variations of the Specific
`methods of the Example are possible. For example, one
`could perform a PCR reaction which adds the oligomers at
`the ends of the genomic DNA to produce the structures
`shown in FIGS. 2E and 2F. These products can then be
`Sequenced with a single primer by means other than dis
`cussed in the Example. It is not necessary to use fluores
`cently labeled primers, radioactively labeled primers can be
`used instead, and it is unnecessary to perform cycle
`Sequencing, rather ordinary Sequencing methods without
`cycling may be utilized. Similarly, there is no need to use the
`M13 Sequences as part of the primers as used in the
`
`15
`
`25
`
`35
`
`40
`
`45
`
`50
`
`55
`
`60
`
`65
`
`6,087,099
`
`8
`Example. This could be replaced by any other known
`Sequence of DNA. Any gene Sequence can be analyzed in
`this manner and the use of BRCA1 or BRCA2 was merely
`intended to be illustrative. These variations and other varia
`tions will be obvious to one of skill in the art and the
`disclosure is meant to be exemplary only and not inclusive
`of the means of performing the invention.
`LIST OF REFERENCES
`Chadwick, R. B., M. P. Conrad, M. D. McGinnis, L.
`Johnston-Dow, S. L. Spurgeon and M. N. Kronick (1996).
`“Heterozygote and Mutation Detection by Direct Auto
`mated Fluorescent DNA Sequencing Using a Mutant Taq
`DNA Polymerase.” BioTechniques 20: 676-683.
`Compton, J. (1991). “Nucleic acid sequence-based amplifi
`cation. Nature 350: 91-92.
`Fahy, E., D. Y. Kwoh and T. R. Gingeras (1991). “Self
`Sustained sequence replication (3SR): an isothermal
`transcription-based amplification System alternative to
`PCR." PCR Methods Appl. 1: 25–33.
`Fischer, S. G. and L. S. Lerman (1983). “DNA fragments
`differing by Single base pair Substitutions Separated in
`denaturing gradient gels: Correspondence with melting
`theory.” Proc. Natl. Acad. Sci. USA 80: 1579–1583.
`Jones, D. H. and S. C. Winistorfer (1992). “Sequence
`specific generation of a DNA panhandle permits PCR
`amplification of unknown flanking DNA. Nucl. Acids.
`ReS. 30: 595-600.
`Ju, J., I. Kheterpal, J. R. Scherer, C. W. Fu