. © 1996 Nature Publishing Group http://www.nature.com/naturemedicine
`........................................................................................................... ARTICLES
`
`markers reveal clonal intratumor heterogeneity in gastrointestinal cancers.
`patients with myelodysplastic syndrome or acute myelogenous leukaemia. Br.
`Cancer Res. 55, 2866—2870 (1995).
`I. Hacmatol. 86, 774—779 (1994).
`14. Nawroz, H., Koch, W., Anker, P., Stroun, M. & Sidransky, D. Microsatellite al-
`12. Sorenson, G.D. et al. Soluble normal and mutated DNA sequences from single-
`terations in serum DNA of head and neck cancer patients. Nature Med. 2,
`copy genes in human blood. Cancer Epidemiol. Biomark. Prev. 3, 67—71 (1994).
`1036—1038 (1996).
`13. Nagel, S. et a}. Somatic mutations detected by mini» and microsatellite DNA
`
`
`Microsatellite alterations
`
`in serum DNA
`
`of head and neck
`
`cancer patients
`
`HOMAIRA NAWRoz‘, WAYNE KOCH‘, PHILIPPE ANKERZ,
`MAURICE STROUN2 & DAVID SIDRANSKY‘
`
`‘Department ofOtolaryngology — Head and Neck Surgery,
`Division ofHead and Neck Cancer Research, [ohns Hopkins University
`School ofMedicine, 818 Ross Research Building,
`720 Rutland Avenue, Baltimore, Maryland 21205—2196
`2Laboratory ofPlant Biochemistry and Physiology,
`Pavilion des Isotopes, Faculty of Science, University of Geneva,
`20 boulevard d’Yvoy, 1211 Geneva 4, Switzerland
`Correspondence should be addressed to D.S.
`
`Microsatellite DNA alterations are an integral part of
`neoplastic progression and are valuable as clonal markers
`for the detection of human cancers”. Moreover, recent
`evidence suggests that senescent tumor cells may release
`DNA into the circulation, which is subsequently carried by
`and therefore enriched in the serum and plasma“. We
`tested 21 patients with primary head and neck squamous
`cell carcinoma (HNSCC) by polymerase chain reaction
`(PCR)-based microsatellite
`analysis
`of DNA from
`lymphocytes and paired serum samples. Patients were
`scored for alterations as defined by the presence of new
`alleles (shifts) or loss of heterozygosity (LOH) in serum at
`each of 12 markers and then compared with primary tumor
`DNA. Six out of 21 patients (29%) were found to have one
`or more microsatellite alterations
`in serum precisely
`matching those in the primary tumors. All six patients had
`advanced disease (stage III or IV); five of these patients had
`nodal metastases,
`three
`later
`developed
`distant
`metastases, and four died of disease. Microsatellite analysis
`of serum represents a novel method for the detection of
`circulating tumor cell DNA. If these results are confirmed in
`larger studies, microsatellite markers may be useful
`in
`assessing tumor burden in cancer patients.
`
`We retrospectively analyzed lymphocyte, serum and tumor DNA
`from 21 head and neck cancer patients. These patients were cho-
`sen from our tumor bank because all three DNA sources were
`
`Furthermore, two trinucleotide (D14SSO and DRPLA) and two
`tetranucleotide (D2181245 and FgA) markers, recognized as
`being prone to microsatellite instability and located on loci com—
`monly altered in cancers, were used in the study for increased
`sensitivity in the detection of shiftsz. LOH was scored if the allele
`signal was reduced to less than 50% of normal intensity, and
`shifts were called if there was an obvious new allele compared
`with normal lymphocyte DNA. Representative alterations (LOH
`and shift) in tumor and serum as compared with lymphocyte
`DNA are shown in Fig. 1.
`A tumor-specific microsatellite shift, represented by a novel al-
`lele after gel electrophoresis, can still be seen when tumor DNA is
`diluted between 1:500 to 121000 with normal DNA (ref. 2). We
`hypothesized that we might see these shifts derived from pri-
`mary tumor cell DNA in the serum; however, we were quite
`surprised to see clear LOH in serum DNA. The first patient that
`had such provocative results was an 80-year-old man diagnosed
`with T,NOMU (see Table 1) glottic cancer who underwent a total
`laryngectomy in January 1993. He had no evidence of disease on
`3 months’ follow-up. However, in September 1993, he was diag-
`nosed with recurrence of tumor in the right neck with the mass
`surrounding the right carotid artery, and he died of regional dis-
`ease in November 1994. The serum DNA of this patient displayed
`a clear LOH (Fig. 1). This result was unexpected and reminiscent
`of the clear LOH and shifts seen in the urine of patients diag-
`nosed with bladder cancerl.
`
`After microsatellite analysis of all specimens was completed,
`clinical data were correlated with the results. The stage, outcome
`and microsatellite analyses of serum and tumor DNA of the 21
`patients (HI—H21) in the study are listed in Table 1. All six pa-
`tients (Hi-H6) that had microsatellite alterations in the serum
`DNA demonstrated identical alterations in the primary tumor
`DNA (Table 2). Four out of six patients displayed alterations in
`more than one locus, and all of these patients had advanced dis-
`ease (stage III—IV). In this small group, four patients went on to
`die from cancer, one patient has terminal cancer with metastases
`and one patient has no evidence of disease at 3 years' follow—up.
`Five patients had nodal metastases and three of them later devel-
`oped distant metastases, one patient to lung and bone and the
`
`a
`
`N
`
`T
`
`P
`
`b
`
`N
`
`T
`
`P
`
`.
`. - 0
`DJSIZJS
`
`- -
`.
`Q a OO -
`
`DZISIZ45
`
`available for complete analysis, and the serum samples had been
`collected before surgical resection of head and neck cancer. We
`selected 12 microsatellite markers to detect shifts or LOH. Eight
`markers were chosen on 9p, 3p and 17p, because these chromo-
`somal arms show the highest percentage of LOH and appear to
`harbor tumor suppressor gene loci involved early in the progres-
`sion of head and neck cancer‘”7 (see the Methods section).
`
`Fig. l Autoradiographs from microsatellite analysis. Representative
`microsatellite analysis of patient serum (P) with corresponding
`HNSCC tumor (T) and lymphocyte (N) DNA with markers indicated
`at the bottom.
`a, In patient H2, serum and tumor DNA reveal loss
`of the upper allele with marker D3$IZ38 compared to normal lym-
`phocyte DNA.
`b, In patient H1, serum and tumor DNA exhibit a
`shift (presence of new top allele) with marker 02751245.
`
`NATURE MEDICINE, VOLUME 2, NUMBER 9, SEPTEMBER 1996
`
`Page 1035
`
`1035
`
`FOUNDATION EXHIBIT 1018
`|PR2019-00634
`
`Page 1035
`
`FOUNDATION EXHIBIT 1018
`
`IPR2019-00634
`
`

`

`ID#
`
`Age/sex
`
`Stage
`
`Tumor
`LOH/shift
`
`Serum
`LOH/shift
`
`O/S
`
`Clinical
`outcome
`
`. © 1996 Nature Publishing Group http://www.nature.com/naturemedicine
`........................................................................................................... ARTICLES
`
`
`.
`.
`.
`.
`.
`.
`Table 1 Microsatelllte analySIs and clInIcal outcome In head and neck cancer patients
`
`‘
`‘
`e t
`0th I WO patlents to lung and liver
`(Table 1).
`Conversely, another nine patients
`(H6—H15) had advanced stage cancer,
`but no microsatellite alterations in
`their serum DNA. Six of these patients
`DOD
`10
`+
`—
`+
`+
`T3N,Mo
`84/M
`H1
`(H6—H11) had successful resections
`DOD
`12
`-
`+
`—
`+
`T.,N0M0
`80/M
`and were free of disease on long-term H2
`NED
`36
`+
`+
`+
`+
`TBNZMO
`51 /M
`follow-up (>1 year); two of them died
`H3
`AWD, distant mets
`44
`-
`+
`—
`+
`T,N,,,M0
`50/M
`within 2 years of diagnosis from re—
`H4
`DOD, distant mets
`20
`+
`+
`+
`+
`TSN.MD
`63/M
`gional recurrence and one was lost to
`H5
`DOD, distant mets
`04
`-
`+
`—
`+
`TaN,Mo
`59/ F
`follow-up. Seven of these patients, in-
`H6
`NED
`14
`—
`—
`—
`+
`T,N,,.,M0
`46/M
`eluding those with a good prognosis,
`H7
`NED
`34
`—
`—
`—
`+
`T,NDMo
`85/F
`exhibited LOH or shifts in their pri-
`H8
`NED
`32
`—
`—
`—
`—
`T3N3MD
`62/ M
`mary tumor DNA but had no evidence
`H9
`NED
`12
`—
`—
`—
`+
`T3N,,M,l
`72/F
`of alterations in serum DNA. Lack of H10
`NED
`36
`—
`-
`—
`+
`TZNZbM0
`41 /M
`positive findings in serum DNA was
`H11
`NED
`29
`—
`—
`—
`+
`TSNZCM0
`56/M
`also seen in 6 out of 21 patients that H12
`DOD
`05
`—
`—
`—
`+
`T3N2bMO
`45/ M
`had stage I and II cancer, all with good
`H13
`LTF
`0
`—
`—
`—
`—
`T3N2bM0
`91 /M
`prognoses except for one patient who H14
`DOD
`10
`—
`—
`—
`+
`aud.canal
`64/M
`had a recurrence 7 years later and
`H15
`NED
`30
`—
`—
`-
`+
`T1N0Mo
`66/M
`died. Of note, three patients (H9, H14
`H16
`NED
`36
`—
`—
`+
`+
`TZNOM0
`46/M
`and H20) displayed no microsatellite H17
`NED
`36
`—
`—
`—
`+
`T1N0MD
`49/M
`alterations in their primary tumor H18
`NED
`56
`—
`—
`+
`+
`T1N0M0
`40/M
`DNA with the markers we tested. In
`H19
`DOD
`88
`—
`—
`—
`—
`T1N0MD
`61 /F
`this small study, the data are statisti— H20
`NED
`44
`-
`—
`—
`+
`TZNOMO
`76/M
`cally significant for a positive serum H21
`
`test as predictor of future distant
`‘
`metastases by the Fisher’s exact test (P
`Clinical data and results of microsatellite analysis. Column 2 shows corresponding age at the
`= 0.015); nevertheless, any conclu-
`time of diagnosis and sex. Stage of HNSCC, according to the tumor-node-metastasis (TNM)
`sions of predictive ability or clinical
`staging system of the American joint Committee on Cancer”, is listed in column 3. Microsatellite
`utility require verification with larger
`data of tumor and plasma DNA. are indicated by + for presence of LOH or shift and — for absence
`populations and well-defined cohorts.
`of these findings. O/S states the overall survival (survival regardless of disease status) period in
`Previous
`studies have proposed months for each patient. Clinical outcome abbreviations: DOD, died of disease; AWD, alive with
`
`that tumor DNA is released into the
`disease; NED, no evidence of disease; mets, metastases; and LTF, lost to follow-up.
`circulation and is enriched in plasma
`fl
`and serum. In one study, the serum of cancer patients was metastatic diseaseq. We also found elevated serum DNA levels in
`found to contain approximately 4 times the amount of free DNA our cancer patients compared with normal controls (see the
`as that of normal controls“. Using a sensitive radioimmunoassay, Methods). Recently, N-ras point mutations have been found
`others found twice the concentration of DNA in patients with
`in plasma DNA of patients with acute myelogenous leukemia”,
`metastatic cancer as in cancer patients without evidence of
`and K-ras point mutations have been shown in plasma DNA
`
`Table 2 Detailed microsatellite analysis of patients with alterations in plasma
`
`Patient
`
`IFNA
`
`095200 D9516]
`
`095156
`
`0351284
`
`0351238
`
`D14550 D2151245
`
`CHRNBl
`
`0175786 FCA
`
`DRPLA
`
`H1 T
`S
`H2 T
`S
`H3 T
`S
`H4 T
`5
`H5 T
`S
`H6 T
`S
`
`
`
`
`
`LOH
`Ret
`
`Ret
`Ret
`
`Ret
`Ret
`LOH
`LOH
`Ret
`Ret
`LOH
`Ret
`
`Ret
`Ret
`
`LOH
`LOH
`Ret
`Ret
`LOH
`LOH
`
`
`
`
`
`
`
`Ret
`Ret
`Ret
`Ret
`Ret
`Ret
`LOH
`LOH
`Ret
`Ret
`
`
`
`LOH
`LOH
`Ret
`Ret
`LOH
`LOH
`Ret
`Ret
`LOH
`LOH
`
`
`
`
`
`Ret
`Ret
`LOH
`LOH
`
`Ret
`Ret
`
`Shift
`Shift
`
`LOH
`LOH
`LOH
`LOH
`Shift
`Shift
`Ret
`Ret
`
`
`
`Ret
`Ret
`Shift
`Shift
`
`Ret
`Ret
`Ret
`Ret
`
`Ret
`Ret
`LOH
`LOH
`Ret
`Ret
`
`
`
`Ret
`Ret
`Ret
`Ret
`
`Ret
`Ret
`Ret
`Ret
`Ret
`Ret
`
`
`
`Rel:
`Ret
`Ref
`Ret
`Ret
`Ret
`LOH
`LOH
`
`Ret
`Ret
`
`Summary of six patients with LOH (loss of heterozygosity) or shifts (new alleles) demonstrated after microsatellite analysis of serum (5) DNA
`with comparison to analysis in tumor (T). All samples were compared to constitutive normal DNA from lymphocytes (see text). Empty boxes
`represent noninformative markers and Ret (retention) indicates informative markers without evidence of loss.
`
`1036
`
`NATURE MEDICINE, VOLUME 2, NUMBER 9, SEPTEMBER 1996
`
`Page 1036
`
`Page 1036
`
`

`

`@ © 1996 Nature Publishing Group http://www.nature.com/naturemedicine
`........................................................................................................... ARTICLES
`
`of patients with colorectal cancer” and pancreatic cancer”.
`In an accompanying study, a much higher frequency of mi-
`crosatellite alterations in plasma was identified in patients with
`small cell lung cancer (SCLC)”. Our study supports the idea of
`tumor DNA enrichment in blood serum and plasma. Moreover,
`serum DNA microsatellite alterations were always identical to al-
`terations in the primary tumor DNA. The higher frequency of
`plasma alterations in small cell lung cancer may reflect the much
`higher frequency of clinical metastases in SCLC patients com-
`pared with head and neck cancer patents. It is plausible that in
`bulky head and neck tumors, cell lysis by necrosis or even apop-
`tosis leads to the release of naked DNA into the circulation. For
`
`large tumors, this phenomenon may occur more frequently be-
`cause of local angiogenesis and necrosis. Although a surprising
`finding, our own studies suggest that tumor DNA readily sur-
`vives in various bodily fluids including urine, stool and sputum.
`However, much work needs to be done to understand the enrich-
`ment of tumor DNA in serum and plasma.
`Head and neck cancer remains a morbid and often fatal dis-
`
`ease“. Large tumor bulk and tumor extension are predictors of
`local regional
`recurrence and poor outcome. We recently
`demonstrated that molecular detection of occult neoplastic cells
`in surrounding surgical margins was a strong predictor of local
`regional recurrence resulting in a significant decrease in overall
`survival”. This small study reveals that serum DNA microsatellite
`alterations are detectable in patients with advanced stage dis-
`ease, usually with poor prognosis including future development
`of distant metastasis. Although shifts and LOH were both seen in
`this study, theoretically, the detection of new alleles by elec-
`trophoresis should be more sensitive for analysis of plasma DNA.
`Identification of clear LOH strongly favors the hypothesis that
`tumor DNA is enriched and, in fact, the predominant form of
`DNA in the plasma. Such analysis of plasma DNA may be useful
`in follow-up of cancer patients receiving medical or surgical
`treatment. Although quite preliminary, the findings are provoca-
`tive and require further investigation of serum and plasma DNA
`in cancer patients for assessment of tumor burden, metastatic
`status and overall prognosis.
`
`Methods
`
`Sample collection and DNA isolation. Tumors from HNSCC patients
`obtained fresh from surgical resection and blood by venipuncture
`were collected from patients at the Johns Hopkins University Medical
`Institutions with prior consent. To obtain serum, clotted blood speci-
`mens were centrifuged at low speed for 5 min, and the serum was
`stored at —80 °C before DNA extraction. Tumor tissue was frozen and
`
`microdissected as previously described”. Lymphocytes, tumor tissue
`and serum were digested in SDS and proteinase K at 48 °C overnight,
`followed by phenol/chloroform extraction and ethanol precipitation
`of DNA (ref. 17). The mean concentration of DNA in our cancer pa-
`tients was 110 i 50 ng per ml serum, and 10 ul was usually sufficient
`for robust microsatellite analysis. The concentration of serum DNA
`from normal controls ranges from O to 100 ng/ml (ref. 8, 9).
`
`PCR amplification. Oligonucleotide markers for microsatellite analysis
`were obtained from Research Genetics
`(Huntsville, Alabama)
`and included IFNA, 095156, D9576], D95200 on 9p; 0357238,
`0351284 on 3p; 0173786 and Chrnbi on 17p. Trinucleotide and
`tetranucleotide primers used included the following: 014550; (F)
`5‘—AACACCCCTAATl'CACCACT—3' and (R) S'—ATGATl'CCACAA—
`GATGGCAG—3', 0275 7245; (F) 5‘—GTCAGTA'|TACCCTGTI'ACCA—3'
`and (R) 5‘—GTTGAGGATITITGCATCAGT—3‘, DRPLA;
`(F) 5'—CAC-
`
`NATURE MEDICINE, VOLUME 2, NUMBER 9, SEPTEMBER 1996
`
`AGTCTCAACACATC—3' and (R) 5'—CCTCCAGTGGGTGGGGAAAT—
`GCTC—3', FgA;
`(F) 5'—CCATAGGTITTGAACTCACAG—3' and (R)
`5'—CTTCTCAGATTCCTTCTI'GACAC—3'. One primer from each set was
`end labeled with (y—SzP) ATP (Amersham) using T4 polynucleotide ki-
`nase (New England Biolabs). PCR amplification was performed with
`30—60 ng DNA as described previously""“. Products were separated
`in 8% denaturing urea-polyacry|amide-formamide gels” followed by
`autoradiography. Loss of heterozygosity was called if the ratio of one
`'allele was significantly decreased (>50%) in tumor or serum DNA
`compared with normal DNA from lymphocytes.
`
`Clinical correlation. Clinical outcome data was obtained from the
`
`Johns Hopkins Head and Neck Cancer Tumor Registry and by chart
`review. Fisher’s exact test was used to compare results from plasma
`analysis with clinical outcome parameters.
`
`Acknowledgments
`This work was supported by a Lung Cancer Specialized Program ofResearch
`Excellence (SPORE) from the National Cancer Institute (CA 58184-01) and
`Oncor, Inc, in Gaithersburg, Maryland. Under an agreement between Oncor
`and the Iohns Hopkins University, BS. is entitled to a share ofsales royalty
`received by the university from Oncor. Under that agreement, the university and
`D. 8. also have received Oncor stock which, under university policy, cannot be
`traded until two years after the first commercial sales of the products related to
`this research. D. 5. also serves as a member of the Scientific Advisory Board of
`OncorMed, Inc., an Oncor subsidiary, which is commercializing some of
`Oncor’s technology. The terms of this arrangement have been reviewed and
`approved by the university in accordance with its conflict-of-interest policies.
`
`RECEIVED 15 MAY; ACCEPTED 24 lULY 1996
`
`1. Mao, L. et al. Molecular detection of primary bladder cancer by microsatellite
`analysis. Science 271, 659—662 (1996).
`2. Mao, L. et al. Microsatellite alterations as clonal markers for the detection of
`human cancer. Proc. Natl. Acad. Sci. USA 91, 9871—9875 (1994).
`3. Merlo, A. et al. Frequent microsatellite instability in primary small cell lung
`cancer. Cancer Res. 54, 2098—2101 (1994).
`4. Stroun, M. et al. Neoplastic characteristics of the DNA found in the plasma of
`cancer patients. Oncology 46, 318—322 (1989).
`5. Stroun, M., Anker, P., Lyautey,J., Lederrey, C. & Maurice, P. Isolation and char-
`acterization of DNA from the plasma of cancer patients. Eur. I. Clin. Oncol. 23,
`707—712 (1987).
`6. Nawroz, H. et al. Allelotype of head and neck squamous cell carcinoma. Cancer
`Res. 54, 1152—1155 (1994).
`7. Califano, J. et al. A genetic progression model for head and neck cancer:
`Implications for field cancerization. Cancer Res. 56, 2488—2492 (1996).
`8. Shapiro, B., et al. Determination of circulating DNA levels in patients with be-
`nign or malignant gastrointestinal disease. Cancer 51, 2116—2120 (1983).
`9, Leon, S.A. et al. Free DNA in the serum of cancer patients and the effect of ther-
`apy. Cancer Res. 37, 646—650 (1977).
`10. Vasioukhin, V. et al. Point mutations of the N-ras gene in the blood plasma:
`DNA of patients with myelodysplastic syndrome or acute myelogenous
`leukaemia. Br. I. Haematol. 86, 774—779 (1994).
`11. Vasioukhin, V. et al. K-ras point mutations in the blood plasma DNA of patients
`with colorectal tumors. in Challenges ofModern Medicine: Biotechnology Today. (eds.
`Verna, R. «St Shamoo, A.) 141—150 (Ares-Serano Syrnposia Publications, Rome, 1994).
`12. Sorenson, G.D. et al. Soluble normal and mutated DNA sequences from single-
`copy genes in human blood. Cancer Epidemiol. Biomark. Prev. 3, 67—71 (1994).
`13. Chen, X.Q. et a1. Microsatellite alterations in plasma DNA of small cell lung
`cancer patients. Nature Med. 2, 1034—1036 (1996).
`14. Vokes, E.E., Weichselbaum, R.R., Lippman, SM. 8r Hong, W.I<. Head and neck
`cancer [review]. N. Engl. I. Med. 328, 184—194 (1993).
`15. Brennan, J. et al. Molecular assessment of histopathological staging in squamous
`cell carcinoma of the head and neck. N. Engl. I. Med. 332, 429—435 (1995).
`16. Boyle, J.O. et al. The incidence of p53 mutations increases with progression of
`head and neck cancer. Cancer Res. 53, 4477—4480 (1993).
`17. Van der Riet, P. et al. Progression of basal cell carcinoma through loss of chr0-
`mosome 9q and inactivation of single p53 allele. Cancer Res. 54, 25—27 (1994).
`18. Sidransky, D. et al. Identification of p53 gene mutations in bladder cancers and
`urine samples. Science 252, 706—709 (1991).
`19. Litt, M., Hauge, X. 81 Sharma, V. Shadow bands seen when typing polymorphic
`dinucleotide repeats: Some causes and cures. Biotechniques 15, 280—284 (1993).
`20. Beahrs, 0., Henson, 0., Hutter, R. «St Myers, M. eds. Manual for Staging ofCancer.
`3rd edn. 27—62 (Lippincott, Philadelphia, 1988).
`
`1037
`
`Page 1037
`
`Page 1037
`
`