(12) United States Patent
`Halenbeck et al.
`
`USOO6322779B1
`US 6,322,779 B1
`(10) Patent No.:
`*Nov. 27, 2001
`(45) Date of Patent:
`
`(54)
`
`(75)
`
`(73)
`
`(21)
`(22)
`
`(63)
`
`(51)
`(52)
`
`(58)
`
`(56)
`
`RECOMBINANT HUMAN CSF-1. DIMER AND
`COMPOSITIONS THEREOF
`
`Inventors: Robert Halenbeck, San Rafael;
`Kirston Koths, El Cerrito; Cynthia
`Cowgill, Berkeley; Walter J. Laird,
`Pinole, all of CA (US)
`Assignee: Chiron Corporation, Emeryville, CA
`(US)
`Subject to any disclaimer, the term of this
`patent is extended or adjusted under 35
`U.S.C. 154(b) by 0 days.
`This patent is Subject to a terminal dis
`claimer.
`
`Notice:
`
`Appl. No.: 08/478,712
`Filed:
`Jun. 7, 1995
`Related U.S. Application Data
`
`Continuation of application No. 08/334,456, filed on Nov. 4,
`1994, now Pat. No. 5,651,963, which is a continuation of
`application No. 07/799,670, filed on Nov. 21, 1991, now
`abandoned, which is a continuation of application No.
`07/430,493, filed on Oct. 31, 1989, now abandoned, which
`is a division of application No. 07/173,428, filed on Apr. 8,
`1988, now Pat. No. 4,929,700, which is a continuation-in
`part of application No. 07/114,001, filed on Oct. 27, 1987,
`now abandoned, which is a continuation-in-part of applica
`tion No. 07/040,174, filed on Apr. 16, 1987, now abandoned.
`
`Int. Cl. .............................................. A61K 45/00
`
`U.S. Cl. ............................. 424/85.1; 514/8; 530/351;
`930/145
`
`Field of Search ..................................... 530/350, 351,
`530/412,395; 424/85.1; 514/8; 930/145
`References Cited
`U.S. PATENT DOCUMENTS
`
`4,338,397
`4,411,994
`4,464,295
`4,476,049
`4,511,502
`4,511,503
`4,512,922
`4,518,526
`4,518,584
`4,530,787
`4,569,790
`4,572,798
`4,599,197
`4,604,377
`4,620,948
`4,656.255
`4,659,568
`4,677,196
`4,711,843
`4,711,844
`4,748.234
`4,766,205
`4,766.224
`4,868,119
`
`7/1982 Gilbert et al..
`10/1983 Gilbert et al..
`8/1984 Bhaduri et al. .
`10/1984 Kung.
`4/1985 Builder et al. .
`4/1985 Olson et al. .
`4/1985 Jones et al. .
`5/1985 Olson.
`5/1985 Mark et al. .
`7/1985 Shaked et al. .
`2/1986 Koths et al. .
`2/1986 Koths et al. .
`7/1986 Wetzel.
`8/1986 Fernandes et al. .
`11/1986 Builder et al. .
`4/1987 Seely .
`4/1987 Heilman, Jr..
`6/1987 Rausch et al. .
`12/1987 Chang.
`12/1987 Chang.
`5/1988 Dorin et al. .
`8/1988 Ghosh-Dastidar.
`8/1988 Rausch.
`9/1989 Clark et al. .
`
`11/1989 Clark et al..
`4,879,227
`12/1992 Cerretti et al..
`5,171,675
`5,650,297 * 7/1997 Takahashi et al................... 435/69.5
`5,651,963 * 7/1997 Halenbeck et al. ................. 424/85.1
`FOREIGN PATENT DOCUMENTS
`4307085
`12/1985 (AU).
`114506
`8/1984 (EP).
`145390
`6/1985 (EP).
`1478.19
`7/1985 (EP).
`156373
`10/1985 (EP).
`158487
`10/1985 (EP).
`185459
`6/1986 (EP).
`215625
`8/1986 (EP).
`196864
`10/1986 (EP).
`206828
`12/1986 (EP).
`208539
`1/1987 (EP).
`212960
`3/1987 (EP).
`218374
`4/1987 (EP).
`2251.56
`6/1987 (EP).
`249477
`12/1987 (EP).
`27 2779
`6/1988 (EP).
`27.6551
`8/1988 (EP).
`289267
`11/1988 (EP).
`328001
`8/1989 (EP).
`328061
`8/1989 (EP).
`WO 85/05637
`12/1985 (WO).
`WO 86/04607
`8/1986 (WO).
`WO 86/05809
`10/1986 (WO).
`WO 86/06385
`11/1986 (WO).
`WO 87/06954
`11/1987 (WO).
`WO 88/08849
`11/1988 (WO).
`WO 88/08850
`11/1988 (WO).
`OTHER PUBLICATIONS
`Abboud et al., “Hydrophobic Adsorption Chromatography
`of Colony-Stimulating Activities and Erythroid-Enhancing
`Activity from the Human Monocyte-Like Cell Lined,
`GCT,” Blood, 58(6):1148–1154 (Dec., 1981).
`Baldwin, R.L., “Intermediates in Protein Folding Reactions
`and the Mechanism of Protein Folding.” Annu. Rev. Bio
`chem., 44:453-475 (1975).
`Baldwin, R.L., Intermediates in Protein, Annual Review
`Biochem., pp. 453-475 (1975).
`Becker et al., Biotech. Advs., 1:247-261 (1983).
`Ben-Avram et al., “Amino Terminal Amino Acid Sequence
`of Murine Colony Stimulating Factor,” Proc. Nat'l Acad.
`Sci., USA, 82(13):4486-4489 (Jul., 1985).
`BioPad Bulletin if 1153.
`(List continued on next page.)
`Primary Examiner-Christine J. Saoud
`(74) Attorney, Agent, or Firm-Donald J. Pochopien;
`Kimberlin L. Morley; Robert P. Blackburn
`(57)
`ABSTRACT
`The present invention is directed to an isolated and purified,
`recombinant, unglycosylated and dimeric CSF-1, the
`dimeric CSF-1 being biologically active and essentially
`endotoxin and pyrogen-free, the dimeric CSF-1 consisting
`essentially of two monomeric human CSF-1 subunits. The
`present invention is further directed to pharmaceutical com
`positions comprising the Same.
`
`14 Claims, 9 Drawing Sheets
`
`Page 1
`
`KASHIV EXHIBIT 1063
`IPR2019-00797
`
`

`

`US 6,322,779 B1
`Page 2
`
`OTHER PUBLICATIONS
`Boss et al., “Assembly of Functional Antibodies from
`Immunoglobulin Heavy and Light Chains Synthesized in E.
`coli,” Nucl. Acids Res., 12(9):3791-3806 (May 11, 1984).
`Cabilly et al., “Generation of Antibody Activity from Immu
`nolgobulin Polypeptide Chains Produced in Escherichia
`coli,” Proc. Nat'l Acad. Sci., USA, 81(11):3273–3277 (Jun.,
`1984).
`Caracciolo et al., “Recominant Human Macrophage Colo
`ny-Stimulating Factor (M-CSG) Requires Subliminal Con
`centrations of Granulocyte/Macrophage (GM)-CSF for
`Optimal Stimulation of Human Macrophage Colony Forma
`tion. In Vitro,” J. Exp. Med., 166(6):1851-1860 (Dec. 1,
`1987).
`Cerretti et al., “Human Macrophage-Colony Stimulating
`Factor: Alternative RNA and Protein Processing form a
`Single Gene,” Mol. Immunol., 25(8):761-770 (Aug., 1988).
`Cetus 2078.4 SN 923,425 Oct. 27, 1986. Wolfgang H.
`Hanisch, et al., Pharmaceutical Composition of Lipophilic
`Proteins, etc.
`Cetus 2266. SN923,383, filed Oct. 27, 1986. Ze'ev Shaked
`et al., Pharmaceutical Compositions of Recombinant Inter
`leukin-2, etc.
`Clark et al., “The Human Hematopoietic Colony-Stimulat
`ing Factors,” Science, 236(4806): 1229–1237 (Jun. 5, 1987).
`CoSman et al., “Human Macrophage Colony Stimulating
`Factor (M-CSF): Alternate RNA Splicing Generates Three
`Different Proteins That are Expressed on the Cell Surface
`and Secreted,” Behring Inst. Mitt., 83:15-26 (Aug., 1988).
`Das et al., “Structure-function Studies of a Colony Stimu
`lating Factor,” J. Biol. Chem..., 257(22): 13679–13684 (Nov.
`25, 1982).
`Dexter, T.M., “Blood Cell Development. The Message in the
`Medium News).” Nature, 309(5971):746–747 (Jun. 28-Jul.
`4, 1984).
`Fetrow et al., “Protein Folding: New Twists,” Biotechnol
`ogy, 6:167–171 (Feb., 1988).
`Hermann et al., “Evidence for Active Intermediates during
`the Reconstruction of Yeast Phosphoglycerate Mutase,” Bio
`chem., 24(8): 1817–1821 (Apr. 9, 1985).
`Hermann et al., “The Reconstruction of Denatured Phos
`phoglycerate Mutase,” J. Biol. Chem..., 258(18): 11014-1019
`(Sep. 25, 1983).
`Jaenicke et al., “Refolding and ASSociation of Oligomeric
`Proteins,” Methods Enzymol., 131:218–250 (1986).
`Kato et al., “Purification and Characterization of Recombi
`nant Human Interleukin 2 Produced in Escherichia coli,”
`Biochem & Biophys. Res. Comm., 130(2):692-699 (1985).
`Kawaguchi et al., “Renaturation and Activation of Calf
`Prochymosin Produced in an Insoluble Form in Escherichia
`coli,” J. Biotech., 1(5-6):307-316 (1984).
`Kawasaki et al., “Molecular Cloning of a Complementary
`DNA Encoding
`Human
`Macrophage-Specific
`Colony-Stimulating
`Factor
`(CSF-1).”
`Science,
`230(4723):291–296 (Oct. 18, 1985).
`Klausner, A., Biotechnology, 4:1041-1043 (1986).
`Kleid et al., Devel. in Indust. Microbiol., 25:317-325
`(1983).
`Ladner et al., “Human CSF-1: Gene Structure and Alterna
`tive Splicing of mRNA Precursors,” EMBO J.,
`6(9):2693–2698 (Sep., 1987).
`Liang et al., “Characterization of Human Interleukin 2”
`Biochem J., 229:429–439 (1985).
`
`Light, A., “Protein Solubility, Protein Modifications and
`Protein Folding.” Biotechniques, 3:298–306 (1985).
`Marston et al., Biotechnology, 2:800-804 (1984).
`Means et al., Chem. Modif of Proteins, Holden-Days, pp.
`221-222.
`Metcalf, D., “Studies on Colony Formation In Vitro by
`Mouse Bone Marrow Cells. II. Action of Colony Stimulating
`Factor,” J. Cell. Physiol., 76(1):89-99 (Aug., 1970).
`Metcalf et al., “The Molecular Biology and Functions of the
`Granulocyte-Macrophage Colony-Stimulating Factors,'
`Blood, 67(2):257–267 (Feb., 1986).
`Moore et al., “Enhanced Responsiveness of Committed
`Macrophage
`Precursors
`tO
`Macrophage-Type
`Colony-Stimulating Factor (CSF-1) Induced In Vitro by
`Interferons Alpha + Beta 1.” J. Immunol., 131(5):2374-2378
`(Nov., 1983).
`Pigiet et al., “Thioredoxin-catalyzed Refolding of Disul
`fide-Containing Proteins.” Proc. Nat'l Acad. Sci., USA,
`83(20):7643–7647 (Oct., 1986).
`Prystowsky et al., “A Microassay for Colony-Stimulating
`Factor Based on Thymidine Incorporation,” Am. J. Path.,
`114(1):149-156 (Jan., 1984).
`Ralph et al., “Colony-Stimulating Factors and Regulation of
`Macrophage Tumoricidal and Microbicidal Activities,” Cell.
`Immunol, 76(1):10–21 (Feb. 15, 1983).
`Remington's Pharmaceutical Sciences, Mack Publishing
`Co., Easton, PA., (latest edition).
`Shiek et al., Arch Biochem. and BiophyS., 253(1):205-213
`(1987).
`Shadduck et al., “A Method for the Removal of Endotoxin
`from Purified Colon-Stimulating Factor,” Proc. Soc. Exp.
`Biol. Med., 164(1):40-44 (May, 1980).
`Sieff, C.A., “Hematopoietic Growth Factors,” J. Clin.
`Invest, 79(6):1549-1557 (Jun., 1987).
`Sofer et al., Biotechniques, pp. 198-203 (Nov./Dec., 1983).
`Sofer, G., “Purification Technologies: Chromatographic
`Removal of Pyrogens,” Biotechnology, 2(12): 1035-1038
`(Dec., 1984).
`Takahashi et al., Biochem. BiophyS. Res.
`152(3):1401–1409 (1988).
`Tietze, F., “Enzymatic Method for Quantitative Determina
`tion of Nanogram Amounts of Total and Oxidized Glu
`tathione: Applications to Mammalian Blood and Other Tis
`sues,” Anal. Biochem., 27(3):502-522 (Mar, 1969).
`Tsuji et al., Biochem., 26:3129–3134 (1987).
`Vadas, M.A., “Activation of Antibody-Dependent Cell-Me
`diated Cytotoxicity of Human Neutrophils and Eosinophils
`by Separate Colony-Stimulating Factors,” J. Immunol.,
`130(2):795–799 (Feb., 1983).
`Wang et al., “Purification of a Human Urinary Colony
`-Stimulating Factor,” J. Cell. Biochem..., 21(4):263-275
`(1983).
`Weber et al., “Reversible Denaturation of Enzymes by
`Sodium
`Dodecyl
`Sulfate,”
`J.
`Biol.
`Chem.,
`246(14):4504–4509 (Jul 25, 1971).
`Weir et al., Symposium On HPLC of Proteins, W. Germany,
`vol. 10, Oct., 1986.
`Wells et al., “Cassette Mutagenesis: An Efficient Method for
`Generation of Multiple Mutations at Defined Sites,” Gene,
`34(2-3):315-323 (1985).
`White et al., Principles of Biochemistry, Fifth Edition,
`McGraw-Hill, Inc., pp. 136–137 (1973).
`Winkler, M.E., Biotechnology, 3:990–999 (1985).
`
`Comm.,
`
`Page 2
`
`

`

`US 6,322,779 B1
`Page 3
`
`Wong et al., “Human CSF-1: Molecular Cloning and
`Expression of 4kb cl)NA Encoding the Human Urinary
`Protein,” Science, 235(4795):1504–1508 (Mar. 20, 1987).
`
`Zuller et al., Nucl. Acids. Res., 10(20):6487-6500 (1982).
`
`* cited by examiner
`
`Page 3
`
`

`

`U.S. Patent
`
`Nov. 27, 2001
`
`Sheet 1 of 9
`
`US 6,322,779 B1
`
`VO
`
`7KD
`
`| O 2
`
`FRACTION NUMBER
`F. G.
`
`Page 4
`
`

`

`U.S. Patent
`
`Nov. 27, 2001
`
`Sheet 2 of 9
`
`US 6,322,779 B1
`
`VO 6OOK 158K 43K 7K
`V y
`V
`V
`v
`
`S-2OO POOL
`
`MONOMER
`V
`
`FRACTION OF SUPEROSE 12 COLUMN RUN IN PBS
`
`F. G. 2A
`
`O.3 MG/ML
`
`FRACTION OF SUPEROSE 12 COLUMN RUN IN PBS
`
`FG. 2B
`
`O. MG/ML
`
`
`
`i
`
`
`
`
`
`W
`
`M1
`
`FRACTION OF SUPEROSE (2 COLUMN RUN IN PBS
`
`FG. 2C
`
`Page 5
`
`

`

`U.S. Patent
`
`Nov. 27, 2001
`
`Sheet 3 of 9
`
`US 6,322,779 B1
`
`POOL
`S-
`(STARTING MATERAL)
`
`i
`
`FG. 3A
`RP-HPLC ANALYSIS ON VYDAC C4 COLUMN IN AN/TFA
`
`RCSF- DMER
`O
`
`S
`St
`CN
`C
`
`6
`O
`
`S
`2.
`a. E
`LS
`y
`a.
`
`RP-HPLC ANALYSIS ON VYDAC C4 COLUMN IN AN/TFA
`
`
`
`S
`s
`N
`N
`C
`es
`l
`
`REDUCED
`RCSF- DMER
`
`6
`p
`m
`2 S
`3u
`f
`LL
`
`H
`1 2
`S.
`
`O
`C
`
`RP-HPLC ANALYSIS ON VYDAC C4 COLUMNIN AN/TFA
`
`Page 6
`
`

`

`U.S. Patent
`
`Nov. 27, 2001
`
`Sheet 4 of 9
`
`US 6,322,779 B1
`
`RCSF-1 DIMER POOL
`
`
`
`O.O5
`
`O.O4
`
`y
`9 O.O3
`
`C
`ha
`
`C
`
`O.O2
`
`O.O
`
`O.
`
`es
`
`Cult Nana
`
`OO 25O 3OO 350 4OO 45O 5OO
`WAVELENGTH (nm)
`
`S-2OO POOL (STARTING MATERAL)
`O.O
`?
`
`O.O8
`
`L
`
`2 OO6
`
`a
`1.
`2 O.O4
`C
`
`O.O2
`
`ool, N-r
`
`2OO 25O 3OO 350 4OO 45O 5OO
`WAVELENGTH (nm)
`FG. 4B
`
`Page 7
`
`

`

`U.S. Patent
`
`Nov. 27, 2001
`
`Sheet 5 of 9
`
`US 6,322,779 B1
`
`0Z/00/0890990?79
`
`001
`
`Page 8
`
`

`

`Sheet 6 of 9
`
`Nov.27, 2001
`
`U.S. Patent
`
`y99abe339919911319919ILyIe999919919919Ret919LILSVOVDILDAY999JOYJILIDLV99Wt9V299¥OVOLV)
`
`AID[eAElyN98]Ne}[eANa]al][eAJagOld[2AN37N93]STHBUd[eAJaSNIDUIDNI]ULOldJAS4aSsasATONTOJasUTDBIYNIDSTH
`O81O9T
`
`iWL3¥91339339¥3997H)V9WWOVDOLE999LILAue999VOYOVIL1399N9WRoYJ9¥99399999¥99LMBygoutJILLO11919299
`dsyU1JUL9]OJJSATONIDO4dUIDNIQN97]OJJasdsyelyBIYUIDOldNIMULOSIHJaSBuyBuyBsyditB4yJAZaygnaznaqATI
`OcOTO00T0860960n6-002
`
`
`
`
`
`
`
`
`
`SVIIIIIIDYQIIIVILILWYVWOLILIDJLOLVVILOLLL9DLIVIVIVO9LIILVIDVILIIDIVOYVLOLLYVO9N9DYSVL919VID919VHS919NVIVOYJW9
`
`
`
`
`
`
`
`
`
`[eAOJdNA?NID[eAU[DB4ydsy
`
`
`
`OniOeTTOOTTO80TO90T0z2OnOT
`
`
`
`
`
`
`
`
`
`
`
`VVLLOLITITLESVLLVIOLLVOWWLLYOYDOLIIELVLILIDLIVLOVDVOOLVIVOLLJOLLIIVLLOLIVINILOVDVLOVOVOWOYJLIOVIDVOLILOLLOLVOVYJILIVLOVIV
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`LLOVVLLOVYJVODLLIVIDLIDIWLILILWIDVOVIIOYVILOLILLIVWVLVIDILLLVIDLLOVLIDJOVVVVLLV3199191999VOLISIVLV)LOLLOLIVIVJivI9LIVWO
`
`
`
`
`
`
`
`
`092TOne0geT00cTO8TTOSTT
`
`
`
`O8ET09STOnctO2sT00STO82T
`
`Page 9
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`VIDILIIIOVLOJILILVILQLILLVVLIDLVYVILOLOLLOVVOLIVLIIVVILIIVILWIDDILILILJVLOLLIIVIDOWVVLLOLLLODVILLOLYLILOVIOLOYVYQIVWLLLL
`
`
`
`
`JLLILIIVIDIDLIOVIIIIVVII9IIIDIQ9LIIIIVILIILLILIVLJIIVILILIOVLOLVILL9OLL91V99D9LLLILOLINIIOLIDDLOWILYOLLV9VI9LIJL9I9L9119
`
`
`
`
`
`
`
`
`00STOShTOShTOnhTOchTOOhT
`
`US 6,322,779 B1
`
`
`
`
`
`
`AVIVLOVIVYLODSLLLWIDLLLTILISLIJLIIDIOLVILOVILILLILIOLIVILILLJIWWIVIILILLOIOLIDILIIVWIOVIL¥III9VIIOVIVIIIOVWII3¥9I919999
`
`
`
`
`
`
`
`
`O¢9TOO9TO8ST09STOnSTo¢ésT
`
`
`
`gG9|Jitavapliiis
`
`Page 9
`
`

`

`U.S. Patent
`
`Nov. 27, 2001
`
`Sheet 7 of 9
`
`US 6,322,779 B1
`
`1
`
`CCCTGCTGTTGTTGGTCTGTCTCCTGGCGAGCAGGAGTATCACC
`-14 LeueueuleuVal CySLeuleu AlaSer ArgSeri leThr
`GAGGAGGTGTCGGAGTACTGTAGCCA CATGATTGGGAGTGGACACCTGCAGTCTCTGCAG
`GluGl UVal SerGluTyrCySSerHiSMETI leGySerGlyHiSLeuGlnSerLeuGln
`CGGCTGATTGACAGTCAGATGGAGA CCTCGTGCCAAATTACATTTGAGTTTGTAGACCAG
`21 ArgleUI leASpSerGlnMETGl UThrSerCysGln I leThrPhe(GluPheVal ASpGln
`GAACAGTTGAAAGATCCAGTGTGCTACCTTAAGAAGGCATTTCTCCTGGTACAAGACATA
`41 Glu (Gln Leuty SASDPrOVal CySTyrLeu LySLySA aPheleuleuVal Gin A Sple
`ATGGAGGACACCATGCGCTTCAGAGATAACACCCCCAATGCCATCGCCATTGTGCAGCTG
`6l METGlu ASpThrMETArgPhe ArgASpASnThrPrOASn Ala I le Ala I leVal Gln Leu
`CAGGAA CTCTCTTTGAGGCTGAAGAGCTGCTTCACCAAGGATTATGAAGAGCATGACAAG
`8l Gin Glu LeuSerLeu ArgLeuySSerCySPheThrySASpTyr GluGluhi SASpyS
`GCCTGCGTCCGAACTTCTATGAGA CACCTCTCCAGTTGCTGGAGAAGGTCAAGAATGTC
`101 Ala CyS Val ArgThrPheTyr GluThrPro Leu Gin Leu LeuGULySWall LySASnVal
`TTTAATGAAACAAAGAATCTCCTTGACAAGGACTGGAATATTTTCAGCAAGAACTGCAAC
`121 Phe ASn Gluhr LySASn Leu Leu ASOLySASpTrpASn I lePheSer LySASnCySASn
`AACAGCTTTGCGAATGCTCCAGCCAAGATGTGGTGACCAAGCCTGATT GCA ACTGCCTG
`14l ASnSerPhe Ala Glu Cy SSer SerGln ASpVal Val Thry SPrOASpCySASnCySLe U
`TACCCCAAAGCCATCCCTAGCAGTGACCCGGCCTCTGTCTCCCCTCATCAGCCCCTCGCC
`161 TyrPrOLySA a lePro Ser Ser ASppro AlaServal SerProHiSG nProLeu Ala
`CCCTCCATGGCCCCTGTGGCTGGCTTGACCTGGGAGGA CTCTGAGGGAACTGAGGGCAGC
`181 PrOSerMETA la PrOVal Ala GlyLeuThrTrpGlu A SpSer Glu GlyThrGlu GlySer
`TCCCTCTTGCCTGGTGAGCAGCCCCTGCACACA GTGGATCCAGGCAGTGCCAAGCAGCGG
`20l SerLeu LeuPrOGlyGUGln ProLeu Hi SThrVal AspproGySer AlaySGln Arg
`CCACCCAGGAGCAC CTGCCAGAGCTTTGAGCCGCCAGAGACCCCAGTTGTCAAGGACAGC
`Pro PrO ArgSerThrCyS GlnSerPheGlu Pro PrOGUThrPrOVal Val LySASpSer
`ACCATCGGTGGCT CACCACAGCCTCGCCCCTCTGTCGGGGCCTTCAA CCCCGGGATGGAG
`241 Thr I le GlyGySerPro Gln Pro ArgroServal Gy Alaphe ASnPrOGlyMETGlu
`GATATTCTTGACTCTGCAATGGGCACTAATTGGGTCCCAGAAGAAGCCTCTGGAGAGGCC
`26l ASDI leLeu ASpSer Ala"ETGlyThrASnTrpVal PrOGUGUAlaSerGlyGlu Ala
`AGTGAGATTCCCGTACCCCAAGGGACAGAGCTTTCCCCCTCCAGGCCAGGAGGGGGCAGC
`Ser Glu I le PrOVal ProGln GlyThrGl ULeuSerProSer Arg PrOGlyGlyGlySer
`F. G. 6A
`
`22
`
`28
`
`44
`
`104
`
`16
`
`224
`
`28l4
`
`544
`
`40 l.
`
`l8l4
`
`52.
`
`584
`
`644
`
`7Ol
`
`764
`
`824
`
`88l4
`
`94.4
`
`Page 10
`
`

`

`U.S. Patent
`
`Nov. 27, 2001
`
`Sheet 8 of 9
`
`US 6,322,779 B1
`
`ATGCAGACAGAGCCCGCCAGACCCAGCAACTTCCTCTCAGCATCTTCTCCACTCCCTGCA 1004
`301 METGlnThrGluPrOAla ArgPrOSer ASn PheleuSer Alaser SerProLeu PrOAla
`TCAGCAAAGGGCCAACAGCCGGCAGATGTAACTGGTACAGCCTTGCCCAGGGTGGGCCCC 1064
`321 Ser Ala LySGlyGln GlnPro Ala ASpVal ThrGlyThr AlaleuPro ArgVal GlyPro
`GTGAGGCCCA CTGGCCAGGACTGGAATCA CACCCCCCAGAAGACAGACCATCCATCTGCC 124
`341 Wal ArgPrOThrGlyGln ASpTrpASnHiSThrprOGlnLySThr ASpHi SProSer Ala
`CTGCTCAGAGACCCCCCGGAGCCAGGCTCTCCCAGGATCTCATCA CTGCGCCCCCAGGGC 1184
`56l Leuleu ArgAS proPro G UPrOGlySerPro Arg leSer SerLeuArgPrOGln Gly
`CTCAGCAA CCCCTCCACCCTCTCTGCTCAGCCACAGCTTTCCAGAAGCCA CTCCTCGGGC 1244
`381 LeuSer ASn PrOSerThrLeuSer AlaGln PrOGln LeuSer ArgSerHiSSerSerGly
`AGCGTGCTGCCCCTTGGGGAGCTGGAGGGCAGGAGGAGCACCAGGGATCGGAGGAGCCCC 1504
`40l SerVal LeuPro LeuGlyGluLeuGluGly ArgArgSerThr ArgASDArgArgSerPrO
`GCAGAGCCAGAAGGAGGACCAGCAAGTGAAGGGGCAGCCAGGCCCCTGCCCCGTTTTAAC 1364
`421 Ala GluprOGluGlyGlyPro AlaSerGlu Gly Ala AlaArgPro LeuprOArgPhe ASn
`TCCGTTCCTTTGACTGACACAGGCCATGAGAGGCAGTCCGAGGGATCCTCCAGCCCGCAG
`lill SerVal ProLeu Thr ASpThrGyHiSG UArgGlnSer Glu (GlySerSerSerPro Gln
`CTCCAGGAGTCTGTCTTCCACCTGCTGGTGCCCAGTGTCATCCTGGTCTTGCTGGCCGTC 148l.
`46l Leu Gln GluSerVal Phe iSLeuleuVal PrOSerVal I le LeuVal Leuleu AlaVal
`GGAGGCCTCTTGTTCTACAGGTGGAGGCGGCGGAGCCATCAAGAGCCTCAGAGAGCGGAT 1544
`l8l GlyGyeu LeuPheTyr Arg Trp Arg Arg ArgSerHi SGln GluprOGin ArgA la ASD
`TCTCCCTTGGAGCAACCAGAGGGCAGCCCCCTGA CTCAGGATGACAGACAGGTGGAACTG 1604
`501 SerProLeu GUGln PrOGuGlySerProLeu ThrGin ASpASpArgGlnVal Glueu
`
`424
`
`521 SASISTAGAGGGAATTCTAGACCCCTCACCATCCTGGACACACTCGTTTGTCATGTC 166l.
`OWa. , , ,
`CCTCTGAAAATGTGACGCCCAGCCCCGGACACAGTACTCCAGATGTTGTCTGACCAGCTC 1724
`AGAGAGA GTACAGTGGGACTGTTACCTTCCTTGATATGGACAGTATTCTTCTATTGTGC 1784
`AGATTAAGATTGCATTAGTTTTTTTCTTAACAACTGCATCATACTGTTGTCATATGTTGA l8l4l
`GCCTGGGTCTATAAAACCCCTAGTTCCATTTCCCAAAACTTCTGTCAAGCCAGACCA 904
`TCTCTACCCTGTACTTGGACAACTTAACTTTTTTAACCAAA GTGCAGTTTATGTTCACCT 1964
`TTGTTAAAGCCACCTTGTGGTTTCTGCCCATCACCTGAACCTACTGAAGTTGTGTGAAAT 2024
`CCTAATTCTGTCATCTCCGTAGCCCTCCCAGTTGTGCCTCCTGCACATTGATGAGTGCCT 2084
`GCTGTTGTCTTTGCCCATGTTGTTGATGTAGCTGTGACCCTATTGTTCCTCACCCCTGCC 2144
`CCCCGCCAA CCCCAGCTGGCCCACCTCTCCCCCTCCCACCCAAGCCCACAGCCAGCCCA 220 li
`TCAGGAAGCCTTCCTGGCTTCTCCACAACCTTCTGACTGCTCTTTTCAGTCATGCCCCTC 2264
`CTGCTCTTTTGTATTTGGCTAATAGTATATCAATTTGC
`F.G. 6B
`
`Page 11
`
`

`

`U.S. Patent
`
`Nov. 27, 2001
`
`Sheet 9 of 9
`
`US 6,322,779 B1
`
`
`
`
`
`
`
`S.K - -
`SK --
`
`3K - -
`
`
`
`
`
`ReON
`
`NON-REDUCING
`
`X, SS-orage
`COO ASSE SANED)
`
`
`
`Page 12
`
`

`

`1
`RECOMBINANT HUMAN CSF-1. DIMER AND
`COMPOSITIONS THEREOF
`
`CROSS-REFERENCE TO RELATED
`APPLICATION
`This application is a continuation of U.S. Ser. No. 08/334,
`456, filed Nov. 4, 1994, now U.S. Pat. No. 5,651,963, which
`is a file wrapper continuation of U.S. Ser. No. 07/799,670,
`filed Nov. 21, 1991, now abandoned, which is a continuation
`of U.S. Ser. No. 07/430,493, filed Oct. 31, 1989, now
`abandoned, which is a division of U.S. Ser. No. 07/173,428,
`filed Apr. 8, 1988, now U.S. Pat. No. 4,929,700, which is a
`continuation-in-part of U.S. Ser. No. 07/114,001, filed Oct.
`27, 1987, now abandoned, which is a continuation-in-part of
`U.S. Ser. No. 07/040,174, filed Apr. 16, 1987, now aban
`doned.
`
`15
`
`TECHNICAL FIELD
`The invention relates to processes for purification and
`refolding of bacterially produced recombinant proteins in
`forms having high Specific biological activity. In particular,
`it concerns procedures which make possible the production
`of biologically active, dimeric forms of CSF-1 from bacte
`rial hosts expressing genes encoding the monomer.
`
`25
`
`BACKGROUND ART
`Colony stimulating factor-1 (CSF-1) is one of several
`proteins which are capable of Stimulating colony formation
`by bone marrow cells plated in Semisolid culture medium.
`CSF-1 is distinguished from other colony stimulating factors
`by virtue of its ability to stimulate these cells to become
`predominantly macrophage colonies. Other CSFS Stimulate
`the production of colonies which consist of neutrophilic
`granulocytes and macrophages, predominantly neutrophilic
`granulocytes, or neutrophilic and eosinophilic granulocytes
`and macrophages. A review of these CSFS has been pub
`lished by Dexter, T. M., Nature (1984) 309:746, and by
`Vadas, M.A., J Immunol (1983) 130:793. There is currently
`no routine in Vivo assay which is known to be specific for
`CSF-1 activity.
`The characteristics of native human CSF-1 are complex,
`and in fact it is not yet clear what form of CSF-1 is active
`in the human body. Soluble forms of naturally-produced
`CSF-1 have been purified to various degrees from human
`urine, mouse L-cells, cultured human pancreatic carcinoma
`(MIA PaCa) cells, and also from various human and mouse
`lung cell conditioned media, from human T-lymphoblast
`cells, and from human placental-conditioned medium.
`Many, if not all of the isolated native CSF-1 proteins appear
`to be glycosylated dimers, regardless of Source. There is
`considerable variety in the molecular weights exhibited by
`the monomeric components of CSF-1, apparently the result
`of variations in C-terminal processing and/or the extent of
`glycosylation. For example, Western analysis shows that the
`CSF-1 secreted by the MIA PaCacell line contains reduced
`monomers of approximately 26 and 30 kd, as well as 40, 48,
`and 70 kd forms. Other CSF-1 molecular weights have been
`reported. For example, the monomeric reduced form of
`CSF-1 isolated from human urine is reported to be of the
`relatively low molecular weight of 25 kd when isolated, and
`14-17 kd when extensively deglycosylated in vitro (Das, S.
`and Stanley, E. R., J Biol Chem (1982) 257:13679).
`The existence of “native-like” CSF-1 reference proteins is
`important because these proteins provide Standards against
`which to compare the quality and biological activity of
`
`35
`
`40
`
`45
`
`50
`
`55
`
`60
`
`65
`
`US 6,322,779 B1
`
`2
`refolded recombinant forms of CSF-1. For this purpose, we
`have relied upon the soluble CSF-1 produced by the Mia
`PaCa cell line as well as properties of other highly purified
`CSF-1 molecules which have been described in the litera
`ture. The specific activity of these purified “native-like”
`reference proteins has typically fallen in the range of 4 to
`10x10 units per mg (as measured by in vitro mouse bone
`marrow colony-forming assays).
`CSF-1 has also been produced from recombinant DNA
`using two apparently related cDNA clones: (1) a “short”
`form which encodes a message which, when translated,
`produces a monomeric protein of 224 amino acids preceded
`by a 32-amino acid signal Sequence (Kawasaki, E. S., et al.,
`Science (1985) 230:292–296, and PCT WO86/04607, both
`of which are incorporated herein by reference); and (2) a
`"long form, encoding a monomeric protein of 522 amino
`acids, also preceded by the 32-amino acid Signal Sequence.
`The long form has been cloned and expressed by two
`groups, as disclosed in Ladner, M. B., et al, The EMBOJ
`(1987) 6(9):2693-2698, and Wong, G., et al, Science (1987)
`235:1504–1509, both of which are incorporated herein by
`reference. (The DNA and amino acid sequences for both
`“short” and “long forms are shown in FIGS. 5 and 6,
`respectively; however, the 32 amino acid Signal Sequence is
`incomplete as illustrated in FIG. 6.)
`The long and short forms of the CSF-1-encoding DNA
`appear to arise from a variable splice junction at the
`upstream portion of eXOn 6 of the genomic CSF-1-encoding
`DNA. When CSF-1 is expressed in certain eucaryotic cells
`from either the long or short cDNA forms, it appears to be
`variably processed at the C-terminus and/or variably glyco
`Sylated. Consequently, CSF-1 proteins of varying molecular
`weights are found when the reduced monomeric form is
`analyzed by Western analysis.
`The amino acid Sequences of the long and short forms, as
`predicted from the DNA sequence of the isolated clones and
`by their relationship to the genomic Sequence, are identical
`with respect to the first 149 amino acids at the N-terminus
`of the mature protein, and diverge thereafter by virtue of the
`inclusion in the longer clone of an additional 894 bp insert
`encoding 298 additional amino acids following glutamine
`149. Both the shorter and longer forms of the gene allow
`expression of proteins with Sequences containing identical
`regions at the C-terminus, as well as at the N-terminus.
`Biologically active CSF-1 has been recovered when cINA
`encoding through the first 150 or 158 amino acids of the
`Short form, or through the first 221 amino acids of the longer
`form, is expressed in eucaryotic cells.
`Since most, if not all, of the native secreted CSF-1
`molecules are glycosylated and dimeric, Significant post
`translational processing apparently occurs in Vivo. Given the
`complexity of the native CSF-1 molecule, it has been
`considered expedient to express the CSF-1 gene in cells
`derived from higher organisms. It seemed unlikely that
`active protein would be obtained when the gene was
`expressed in more convenient bacterial hosts, Such as E. coli.
`Bacterial hosts do not have the capacity to glycosylate
`proteins, nor are their intracellular conditions conducive to
`the refolding, disulfide bond formation, and disulfide
`Stabilized dimerization which is apparently essential for full
`CSF-1 activity. Thus, experimental production of recombi
`nant CSF-1 in E. coli has, prior to this invention, resulted in
`protein of very low activity, although its identification as
`monomeric CSF-1 had been readily confirmed by
`immunoassay, N-terminal Sequencing, and amino acid
`analysis.
`It is by now accepted that inactive forms of recombinant
`foreign proteins produced in bacteria may require further
`
`Page 13
`
`

`

`US 6,322,779 B1
`
`15
`
`25
`
`35
`
`40
`
`3
`“refolding” steps in order to render them useful for the
`purposes for which they are intended. As a dimeric protein
`containing a large number of cysteines and disulfide bonds,
`which are required for activity, CSF-1 represents a particu
`larly difficult challenge for production from bacterial Sys
`tems. Often, recombinant proteins produced in E. coli,
`including CSF-1 so produced, are in the form of highly
`insoluble intracellular protein precipitates referred to as
`inclusion bodies or refractile bodies. These inclusions can
`readily be separated from the Soluble bacterial proteins, but
`then must be solubilized under conditions which result in
`essentially complete denaturation of the protein. Even
`Secreted proteins from bacterial Sources, while not neces
`Sarily presenting the Same Solubility problems, may require
`considerable manipulation in order to restore activity. Each
`different protein may require a different refolding protocol in
`order to achieve full biological activity.
`A number of paperS have appeared which report refolding
`attempts for individual proteins produced in bacterial hosts,
`or which are otherwise in denatured or non-native form. A
`representative Sample follows.
`Reformation of an oligomeric enzyme after denaturation
`by sodium dodecyl sulfate (SDS) was reported by Weber, K.,
`et al., J Biol Chem (1971) 246:4504-4509. This procedure
`was considered to Solve a problem created by the binding of
`proteins to SDS, and the process employed removal of the
`denatured protein from SDS in the presence of 6 Murea,
`along with anion exchange to remove the SDS, followed by
`dilution from urea, all in the presence of reducing agents.
`The proteins which were at least partially refolded included:
`aspartate transcarbamylase, B-galactosidase, rabbit muscle
`aldolase, and coat protein from bacteriophage R-17.
`Light, A., in Biotechniques (1985)3:298–306, describes a
`variety of attempts to refold a large number of proteins. It is
`apparent from the description in this reference that the
`techniques which are applicable are highly individual to the
`particular protein concerned. In fact, in Some cases, refold
`ing Significant amounts of particular proteins has not been
`possible and the results are quite unpredictable. In addition,
`refolding procedures for recombinant urokinase produced in
`E. coli were described in Winkler, M. E., Biotechnology
`(1985)3:990–999. In this case, the material was dissolved in
`8 Murea or 5 M guanidine hydrochloride, and the rear
`rangement of disulfides was facilitated by use of a buffer
`containing a glutathione redox System. Recombinant human
`immune interferon, which has no disulfide bonds, has been
`refolded to generate a more active preparation using chao
`tropic agents in the absence of thiol-disulfide exchange
`reagents (PCT application WO 86/06385). In another
`example, bacterially Synthesized granulocyte macrophage
`colony-stimulating factor (GM-CSF), a member of the CSF
`group, was also produced in E. coli and refolded after
`Solubilization in 6 Murea. This CSF is unrelated to CSF-1,
`Since GM-CSF has a distinct amino acid Sequence and is
`also monomeric.
`Use of refolding procedures to obtain reconstitution of
`activity in multimeric proteins has also been described by
`Herman, R. H., et al, Biochemistry (1985) 24:1817–1821,
`for phosphoglycerate mutase, and by Cabilly, S., Proc Natl
`AcadSci USA (1984) 81:3273–3277, for immunoglobulins.
`An additional procedure for immunoglobulin reassembly
`was described by Boss, M.A., et al, Nucleic Acids Research
`(1984) 12:3791-3806. These procedures all employ dena
`turation and the use of appropriate oxidizing and reducing
`agents or Sulfitolysis reagents. A related approach employs
`the catalyst thioredoxin, and is disclosed by Pigiet, V. P.,
`Proc Natl AcadSci USA (1986) 83:7643–7647.
`
`45
`
`50
`
`55
`
`60
`
`65
`
`4
`Certain aspects of Solubilization, purification, and refold
`ing of certain recombinant proteins produced as refractile
`bodies in bacteria are also disclosed in U.S. Pat. Nos.
`4.511,562; 4,511,503; 4,512,912; 4,518,526 and EPO pub
`lication 114,506 (Genentech).
`The foregoing references are merely representative of a
`large body of literature which, when taken together, shows
`individual Steps in protocols which may be modified and
`combined in various Sequences to obtain individually tai
`lored procedures for particular Subject proteins produced in
`accordance with particular expression Systems. It is evident
`that retailoring of the overall procedures to fit a Specific case
`is a requirement for producing refolded product with full
`biological activity in useful amounts.
`For example, a number of the published procedures
`describe a step for Successful refolding of the recombinantly
`produced protein. It is not clear from these references, but is
`known in the art, that the Starting material for refolding may
`exist in a variety of forms, depending on the nature of the
`expression System used. In the case of bacterial expression,
`it is, however, clear that the product is not glycosylated, and
`that, in addition, production of an intracellular disulfide
`bonded dimeric product is prevented by the reducing envi
`ronment in bacterial cells.
`Currently the most common form of recombinant protein
`Starting material for refolding is an intracellular, insoluble
`protein which is produced by expression of a gene for
`mature or bacterial fusion protein, lacking a functional
`Signal Sequence, under the control of Standard bacterial
`promoters Such as Trp or P. Because recombinantly pro
`duced products in bacteria are produced in high concentra
`tions in a reducing environment, and because typically the
`constructs do not enable the bacteria to Secrete the recom
`binant protein, these foreign proteins are often observed to
`form insoluble inclusion bodies.
`However, Signal Sequences which function in bacteria are
`known, including the E. coli penicillinase Sequence dis
`closed by Gilbert et al., U.S. Pat. Nos. 4,411,994 and
`4.338,397, the B. licheniformis penPsequences disclosed by
`Chang in U.S. Pat. Nos. 4,711,843 and 4,711,844, and the
`phosphatase A signal sequence (phoA) disclosed by Chang,
`et al., in European Patent Publication No. 196.864, published
`Oct. 8, 1986, and incorporated herein by reference. Secre
`tion can be effected in Some strains. However, if Gram
`negative hosts are used, complete Secretion may not occur,
`and the protein may reside in the periplasmic Space.
`Nevertheless, it is much more likely that proteins expressed
`under control of promoters and Signal Sequences Such as
`phoA will be produced in soluble form if they are capable of
`refolding and forming required disulfide bonds in the extra
`cellular environment. The methods disclosed hereinbelow
`are expected to be of value for both intracellular