UNITED STATES PATENT AND TRADEMARK OFFICE
`
`APPLICATION
`NUMBER
`61/180,609
`
`FILING or
`37l(c)DATE
`05/22/2009
`
`GRPART
`UNIT
`
`FIL FEE REC'D
`220
`
`37462
`LANDO & ANASTASI, LLP
`ONE MAIN STREET, SUITE 1100
`CAMBRIDGE, MA 02142
`
`Ul\TfED STATES DEPA RTME'IT OF COMMERCE
`United States Patent and Trademark Office
`Adiliess. COMMISSIO'JER FOR PATENTS
`PO Box 1450
`Alexandria, Virgmia 22313-1450
`\VVi\V.USpto.gov
`
`ATTY.DOCKET.NO
`C2081-701303
`
`TOT CLAIMS IND CLAIMS
`
`CONFIRMATION NO. 4921
`FILING RECEIPT
`
`11111111111111111 lllll ll]~!l]!~l!~l!~U!II! ~H] 11111111111111111111111
`
`Date Mailed: 08/10/2009
`
`Receipt is acknowledged of this provisional patent application. It will not be examined for patentability and will
`become abandoned not later than twelve months after its filing date. Any correspondence concerning the application
`must include the following identification information: the U.S. APPLICATION NUMBER, FILING DATE, NAME OF
`APPLICANT, and TITLE OF INVENTION. Fees transmitted by check or draft are subject to collection. Please verify
`the accuracy of the data presented on this receipt. If an error is noted on this Filing Receipt, please submit
`a written request for a Filing Receipt Correction. Please provide a copy of this Filing Receipt with the
`changes noted thereon. If you received a "Notice to File Missing Parts" for this application, please submit
`any corrections to this Filing Receipt with your reply to the Notice. When the USPTO processes the reply
`to the Notice, the USPTO will generate another Filing Receipt incorporating the requested corrections
`
`Applicant( s)
`
`Stefan Gross, Brookline, MA;
`Shengfang Jin, Newton, MA;
`Shinsan Su, Cambridge, MA;
`Valeria Fantin, Cambridge, MA;
`Lenny Dang, Boston, MA;
`Katharine Yen, Wellesley, MA;
`Power of Attorney:
`Catherine McCarty--54301
`
`If Required, Foreign Filing License Granted: 08/06/2009
`The country code and number of your priority application, to be used for filing abroad under the Paris Convention,
`is US 61 /180,609
`Projected Publication Date: None, application is not eligible for pre-grant publication
`Non-Publication Request: No
`Early Publication Request: No
`Title
`
`METHODS OF TREATING CANCER HAVING SOMATIC MUTATIONS OF THE ISOCITRATE
`DEHYDROGENASE GENE
`
`PROTECTING YOUR INVENTION OUTSIDE THE UNITED STATES
`
`Since the rights granted by a U.S. patent extend only throughout the territory of the United States and have no
`effect in a foreign country, an inventor who wishes patent protection in another country must apply for a patent
`page 1 of 3
`
`Rigel Exhibit 1046
`Page 1 of 167
`
`

`

`in a specific country or in regional patent offices. Applicants may wish to consider the filing of an international
`application under the Patent Cooperation Treaty (PCT). An international (PCT) application generally has the same
`effect as a regular national patent application in each PCT-member country. The PCT process simplifies the filing
`of patent applications on the same invention in member countries, but does not result in a grant of "an international
`patent" and does not eliminate the need of applicants to file additional documents and fees in countries where patent
`protection is desired.
`
`Almost every country has its own patent law, and a person desiring a patent in a particular country must make an
`application for patent in that country in accordance with its particular laws. Since the laws of many countries differ
`in various respects from the patent law of the United States, applicants are advised to seek guidance from specific
`foreign countries to ensure that patent rights are not lost prematurely.
`
`Applicants also are advised that in the case of inventions made in the United States, the Director of the US PTO must
`issue a license before applicants can apply for a patent in a foreign country. The filing of a U.S. patent application
`serves as a request for a foreign filing license. The application's filing receipt contains further information and
`guidance as to the status of applicant's license for foreign filing.
`
`Applicants may wish to consult the USPTO booklet, "General Information Concerning Patents" (specifically, the
`section entitled "Treaties and Foreign Patents") for more information on timeframes and deadlines for filing foreign
`patent applications. The guide is available either by contacting the USPTO Contact Center at 800-786-9199, or it
`can be viewed on the USPTO website at http://www.uspto.gov/web/offices/pac/doc/general/index.html.
`
`For information on preventing theft of your intellectual property (patents, trademarks and copyrights), you may wish
`to consult the U.S. Government website, http://www.stopfakes.gov. Part of a Department of Commerce initiative,
`this website includes self-help "toolkits" giving innovators guidance on how to protect intellectual property in specific
`countries such as China, Korea and Mexico. For questions regarding patent enforcement issues, applicants may
`call the U.S. Government hotline at 1-866-999-HAL T (1-866-999-4158).
`
`LICENSE FOR FOREIGN FILING UNDER
`
`Title 35, United States Code, Section 184
`
`Title 37, Code of Federal Regulations, 5.11 & 5.15
`
`GRANTED
`
`The applicant has been granted a license under 35 U.S.C. 184, if the phrase "IF REQUIRED, FOREIGN FILING
`LICENSE GRANTED" followed by a date appears on this form. Such licenses are issued in all applications where
`the conditions for issuance of a license have been met, regardless of whether or not a license may be required as
`set forth in 37 CFR 5.15. The scope and limitations of this license are set forth in 37 CFR 5.15(a) unless an earlier
`license has been issued under 37 CFR 5.15(b). The license is subject to revocation upon written notification. The
`date indicated is the effective date of the license, unless an earlier license of similar scope has been granted under
`37 CFR 5.13 or 5.14.
`
`This license is to be retained by the licensee and may be used at any time on or after the effective date thereof unless
`it is revoked. This license is automatically transferred to any related applications(s) filed under 37 CFR 1.53(d). This
`license is not retroactive.
`
`page 2 of 3
`
`Rigel Exhibit 1046
`Page 2 of 167
`
`

`

`The grant of a license does not in any way lessen the responsibility of a licensee for the security of the subject matter
`as imposed by any Government contract or the provisions of existing laws relating to espionage and the national
`security or the export of technical data. Licensees should apprise themselves of current regulations especially with
`respect to certain countries, of other agencies, particularly the Office of Defense Trade Controls, Department of
`State (with respect to Arms, Munitions and Implements of War (22 CFR 121-128)); the Bureau of Industry and
`Security, Department of Commerce (15 CFR parts 730-774); the Office of Foreign AssetsControl, Department of
`Treasury (31 CFR Parts 500+) and the Department of Energy.
`
`NOT GRANTED
`
`No license under 35 U.S.C. 184 has been granted at this time, if the phrase "IF REQUIRED, FOREIGN FILING
`LICENSE GRANTED" DOES NOT appear on this form. Applicant may still petition for a license under 37 CFR 5.12,
`if a license is desired before the expiration of 6 months from the filing date of the application. If 6 months has lapsed
`from the filing date of this application and the licensee has not received any indication of a secrecy order under 35
`U.S.C. 181, the licensee may foreign file the application pursuant to 37 CFR 5.15(b).
`
`page 3 of 3
`
`Rigel Exhibit 1046
`Page 3 of 167
`
`

`

`Doc Code: TR.PROV
`Document Description: Provisional Cover Sheet (SB16)
`
`PTO/SB/16 (04-07)
`Approved for use through 06/30/2010 0MB 0651-0032
`U.S. Patent and Trademark Office: U.S. DEPARTMENT OF COMMERCE
`Under the Paperwork Reduction Act of 1995, no persons are required to respond to a collection of information unless it displays a valid 0MB control number
`Provisional Application for Patent Cover Sheet
`This is a request for filing a PROVISIONAL APPLICATION FOR PATENT under 37 CFR 1.53(c)
`
`lnventor(s)
`
`Inventor 1
`
`Given Name
`
`Middle Name
`
`Family Name
`
`City
`
`State
`
`Stefan
`
`Inventor 2
`
`Gross
`
`Brookline
`
`MA
`
`Given Name
`
`Middle Name
`
`Family Name
`
`City
`
`State
`
`Shengfang
`
`Inventor 3
`
`Jin
`
`Newton
`
`MA
`
`Given Name
`
`Middle Name
`
`Family Name
`
`City
`
`State
`
`Shinsan
`
`Inventor 4
`
`Su
`
`Cambridge
`
`MA
`
`Given Name
`
`Middle Name
`
`Family Name
`
`City
`
`State
`
`Valeria
`
`Inventor 5
`
`Fantin
`
`Cambridge
`
`MA
`
`Given Name
`
`Middle Name
`
`Family Name
`
`City
`
`State
`
`Lenny
`
`Inventor 6
`
`Dang
`
`Boston
`
`MA
`
`Given Name
`
`Middle Name
`
`Family Name
`
`City
`
`State
`
`Katharine
`
`Yen
`
`Wellesley
`
`MA
`
`All Inventors Must Be Listed -Additional Inventor Information blocks may be
`generated within this form by selecting the Add button.
`
`I Remove I
`Country
`
`us
`
`I Remove I
`Country
`
`us
`
`I Remove I
`Country
`
`us
`
`I Remove I
`Country
`
`us
`
`I Remove I
`Country
`
`us
`
`I Remove I
`Country
`
`us
`
`I Add
`
`I
`
`i
`
`i
`
`i
`
`i
`
`i
`
`i
`
`Title of Invention
`
`METHODS OF TREATING CANCER HAVING SOMATIC MUTATIONS OF
`THE ISOCITRATE DEHYDROGENASE GENE
`
`Attorney Docket Number (if applicable)
`
`C2081-701303
`
`Correspondence Address
`
`EFS - Web 1.0.1
`
`Rigel Exhibit 1046
`Page 4 of 167
`
`

`

`Doc Code: TR.PROV
`Document Description: Provisional Cover Sheet (SB16)
`
`PTO/SB/16 (04-07)
`Approved for use through 06/30/2010 0MB 0651-0032
`U.S. Patent and Trademark Office: U.S. DEPARTMENT OF COMMERCE
`Under the Paperwork Reduction Act of 1995, no persons are required to respond to a collection of information unless it displays a valid 0MB control number
`
`Direct all correspondence to (select one):
`
`0 The address corresponding to Customer Number
`
`0 Firm or Individual Name
`
`Customer Number
`
`37462
`
`The invention was made by an agency of the United States Government or under a contract with an agency of the United
`States Government.
`0 No.
`0 Yes, the name of the U.S. Government agency and the Government contract number are:
`
`EFS - Web 1.0.1
`
`Rigel Exhibit 1046
`Page 5 of 167
`
`

`

`Doc Code: TR.PROV
`Document Description: Provisional Cover Sheet (SB16)
`
`PTO/SB/16 (04-07)
`Approved for use through 06/30/2010 0MB 0651-0032
`U.S. Patent and Trademark Office: U.S. DEPARTMENT OF COMMERCE
`Under the Paperwork Reduction Act of 1995, no persons are required to respond to a collection of information unless it displays a valid 0MB control number
`
`Entity Status
`Applicant claims small entity status under 37 CFR 1.27
`0 Yes, applicant qualifies for small entity status under 37 CFR 1.27
`® No
`Warning
`
`Petitioner/applicant is cautioned to avoid submitting personal information in documents filed in a patent application that may
`contribute to identity theft. Personal information such as social security numbers, bank account numbers, or credit card
`numbers (other than a check or credit card authorization form PT0-2038 submitted for payment purposes) is never required
`by the USPTO to support a petition or an application. If this type of personal information is included in documents submitted
`to the USPTO, petitioners/applicants should consider redacting such personal information from the documents before
`submitting them to USPTO. Petitioner/applicant is advised that the record of a patent application is available to the public
`after publication of the application (unless a non-publication request in compliance with 37 CFR 1.213(a) is made in the
`application) or issuance of a patent. Furthermore, the record from an abandoned application may also be available to the
`public if the application is referenced in a published application or an issued patent (see 37 CFR1 .14). Checks and credit
`card authorization forms PT0-2038 submitted for payment purposes are not retained in the application file and therefore are
`not publicly available.
`
`Signature
`
`Please see 37 CFR 1.4(d} for the form of the signature.
`
`Signature
`
`/Catherine M. McCarty/
`
`Date (YYYY-MM-DD)
`
`2009-05-22
`
`First Name
`
`Catherine
`
`Last Name
`
`McCarty
`
`Registration Number
`(If appropriate)
`
`54301
`
`This collection of information is required by 37 CFR 1.51. The information is required to obtain or retain a benefit by the public which is to
`file (and by the USPTO to process) an application. Confidentiality is governed by 35 U.S.C. 122 and 37 CFR 1.11 and 1.14. This collection
`is estimated to take 8 hours to complete, including gathering, preparing, and submitting the completed application form to the USPTO.
`Time will vary depending upon the individual case. Any comments on the amount of time you require to complete this form and/or
`suggestions for reducing this burden, should be sent to the Chief Information Officer, U.S. Patent and Trademark Office, U.S. Department
`of Commerce, P.O. Box 1450, Alexandria, VA 22313-1450. DO NOT SEND FEES OR COMPLETED FORMS TO THIS ADDRESS. This
`form can only be used when in conjunction with EFS-Web. If this form is mailed to the USPTO, it may cause delays in handling
`the provisional application.
`
`EFS - Web 1.0.1
`
`Rigel Exhibit 1046
`Page 6 of 167
`
`

`

`Privacy Act Statement
`
`The Privacy Act of 1974 (P.L. 93-579) requires that you be given certain information in connection with your submission of
`the attached form related to a patent application or paten. Accordingly, pursuant to the requirements of the Act, please be
`advised that : (1) the general authority for the collection of this information is 35 U.S.C. 2(b)(2); (2) furnishing of the
`information solicited is voluntary; and (3) the principal purpose for which the information is used by the U.S. Patent and
`Trademark Office is to process and/or examine your submission related to a patent application or patent. If you do not
`furnish the requested information, the U.S. Patent and Trademark Office may not be able to process and/or examine your
`submission, which may result in termination of proceedings or abandonment of the application or expiration of the patent.
`
`The information provided by you in this form will be subject to the following routine uses:
`
`1.
`
`2.
`
`3.
`
`4.
`
`5.
`
`6.
`
`7.
`
`8.
`
`9.
`
`The information on this form will be treated confidentially to the extent allowed under the Freedom of Information
`Act (5 U.S.C. 552) and the Privacy Act (5 U.S.C 552a). Records from this system of records may be disclosed to the
`Department of Justice to determine whether disclosure of these records is required by the Freedom of Information
`Act.
`A record from this system of records may be disclosed, as a routine use, in the course of presenting evidence to
`a court, magistrate, or administrative tribunal, including disclosures to opposing counsel in the course of settlement
`negotiations.
`A record in this system of records may be disclosed, as a routine use, to a Member of Congress submitting a
`request involving an individual, to whom the record pertains, when the individual has requested assistance from the
`Member with respect to the subject matter of the record.
`A record in this system of records may be disclosed, as a routine use, to a contractor of the Agency having need
`for the information in order to perform a contract. Recipients of information shall be required to comply with the
`requirements of the Privacy Act of 1974, as amended, pursuant to 5 U.S.C. 552a(m).
`A record related to an International Application filed under the Patent Cooperation Treaty in this system of
`records may be disclosed, as a routine use, to the International Bureau of the World Intellectual Property
`Organization, pursuant to the Patent Cooperation Treaty.
`A record in this system of records may be disclosed, as a routine use, to a n other federal agency for purposes
`of National Security review (35 U.S.C. 181) and for review pursuant to the Atomic Energy Act (42 U.S.C. 218(c)).
`A record from this system of records may be disclosed, as a routine use, to the Administrator, General Services,
`or his/her designee, during an inspection of records conducted by GSA as part of that agency's responsibility to
`recommend improvements in records management practices and programs, under authority of 44 U.S.C. 2904 and
`2906. Such disclosure shall be made in accordance with the GSA regulations governing inspection of records for this
`purpose, and any other relevant (i.e., GSA or Commerce) directive. Such disclosure shall not be used to make
`determinations about individuals.
`A record from this system of records may be disclosed, as a routine use, to the public after either publication of
`the application pursuant to 35 U.S.C. 122(b) or issuance of a patent pursuant to 35 U.S.C. 151. Further, a record
`may be disclosed, subject to the limitations of 37 CFR 1.14, as a routine use, to the public if the record was filed in an
`application which became abandoned or in which the proceedings were terminated and which application is
`referenced by either a published application, an application open to public inspection or an
`issued patent.
`A record from this system of records may be disclosed, as a routine use, to a Federal, State, or local law
`enforcement agency, if the USPTO becomes aware of a violation or potential violation of law or regulation.
`
`Rigel Exhibit 1046
`Page 7 of 167
`
`

`

`,60
`
`,70
`
`,80
`
`,90
`
`,100
`
`11(1
`
`I 120
`
`130
`
`J40
`
`,150
`
`164
`
`IDH1(CDS)
`pET41a-lDH1
`Consensus
`
`___,__. _ _ _ _ _ _ _ _ _ ___.._._ .......... '----_.....,_ _ _
`
`_____ ........, ______________ .,__ __ ,.__ ______ _
`
`(55) 55
`(1)
`(55)
`(55) ATGTCCAAAAAAATCAGTGGCGGTTCTGTGGTAGAGATGCAAGGAGATGAAATGACACGAATCATTTGGGAATTGATTAAAGAGAAACTCATTTTTCCCTACGTGGAATT
`(163) 163
`,:.70
`,180
`,190
`,200
`,210
`,220
`,2.30
`,240
`,250
`,260
`272
`IDHl(CDS) (109)
`pET41a-lDH1 (163) , J.'"'''' ,,, ,n.,ru.·,,r,,,
`Consensus (163)
`(271) _ _ "--_.......,,__ _ _ "'---_
`IDHl(CDS) (217)
`pET41a-lDH1 (271) m,7 '1".'V••·"···•ci,;nv<o
`Consensus f 27 ll Wrf ·~"--'-'"'-- H '"'!hWcam ",v,mG"t1.'mn'1m' ·;;nt1 1JtllJ 1J 1J j, .,L,\Jtl 1CJ\Jt1 1Jll \,t;\l;\'J 1 .1 \Jt1h"'iyt:i/-i.'il
`379
`IDHl(CDS) (325) ]f;AcJV~GCCiVITAI'CIGCA},AJ'-Al'ATC(\'.CC(::GcT'.l'GTG]~::;:rcr~A'l'G(X::IA:~AAO::::rAT1CATCATAGGTCCTCAI'GC'nAT(X:GGA'l'CAA}ACN;AGCl,ACT(;xrrn::;:r
`pET41a-lDH1 (379) •.Y•.•i ,.JJ• c•.Y-"••-•i '·'·
`Consensus ( 379l '-/MJ;l \Jlll l\J\. '"" ll TA l~:JGCi/JJ\AAA l ~;r CCC'CCG(;mGTGl\GTGGEiJ(;GGTAAAl;\ CCTATC]\ Tc~r hG(;TCG'TC~ J"f,CT'rA TC:GGG1~ TCA,ATA 1:~G-~-GCAi~CTG;A 1rcrcrcr,7 cr
`(487 _ _ _ __._ _ _ _ _ _ ....._ ______ _,_ _ _ _,__ _ _ .,__ _ __. _ _ __._ _ _ _ _
`IDH1(CDS) ( 433)
`pET 41a-IDH1 ( 487)
`Consensus ( 487J l"''l''l'(''l'J~G('nf"''l''Gl"'(S'G('1r::,c('T'l'Gr;G('}~N;AGT'AGb("l;hTAACC'rACEiCAC(:AAGTGb{:GGAACCC:bMAGGJ'GAC.~lhC:CTGiGTAC:~JAinicTT"TGbiSf:;AA,GGT1;GJG:r,TG'rTGCCATl~GG
`(595 -~--~----~--~-----~--------~---
`ID H 1 (CDS) (541) 'J•.1'Cil'.,"Jsc·,111c'.s\ .. i'.c·,,~•,ioi'-'.·,,_,
`pET41a-IDH1 (595) ,-···.·.-.. ,, .... >c<.
`Consensus (595) 'JCJ'JlH'JCJ.HrnJC'vllll'JlU,llllvC'vrnH
`(703) 70.3
`,710
`IDHl(CDS) (649) fol"~,,,u . . ,,s·o,'.,"C.•YCA,•.1'" c Ul.'.U:'."Ch'.'.,,'.,'~" c
`pET 4 la-IDHl (703)
`Consensus (703l MGl\AATATG~1JGGGCGJ"Tn1MA(r;A(r::A•' T~,n'l''l'l"',__,i:~,1"',J(\,m~ ,,~Jfl~ 'l'~"'i'" cr,11
`7JDil"',__,D~fl U)'',;,,.('P·, ('\J cr,nif"',__,nin,-1..,;,,.'--'--'D\Jl TGMGCn:AAA.~GhT'CTG(;TAJGhGC:ATA1;G(J~ATC:GAQ~~
`11 er, 1
`(811
`-,::,:;;,::;.";;.:;:: .. ~:;;.--;;:; .. ;7,.:;;;~:;:,7..;;:-;:;,-;;-:;:;::,~::;0:~~;-:, .. ::7.::~~::;:::;:;,~::;:;:;;,-::;:;:;;,--:;;: .. 0i;,~~;:;-.::;::-:;;,,~:;::-;;.-:;;.;: .. ~·~.-:;;,.~,;z::;.~
`IDHl(CDS) (757)
`pET 4 la-lDHl (811) ,:;AO:t,:;i;'.:'CGC:YAAGC
`Consensus (81 ll ~~f.},TC;G'Tc"GC;cr;(,,im,J\,_,
`(919 - - - - -~ - - - - - - - - - - - - - -~ - -~ - - - - - - -
`ID H 1 (CDS) (865) GGc;·Tc;xr-,_;;/,:C'i,:,u,
`
`,_,,,_,-c,,c•o,.a,u,1c-.1c1, .. ,u'.•.1',i'.'C,U:,'vi:Cf•.'
`
`812
`
`Consensus (919) \J\J\.,I"ll\JD.Ll.lDVvD\J\.,\Jl\J\.,
`(1027) _ _ _ ~ - ~ - - - - ~ - - ~ - - - - ~ - - ~ - ~ - - - -
`IDHl(CDS) (973) ,, \"l("C•r'I'?. r,,._, ;, "'(':·,,,,, m,•,-,:·•r·"r-•,-r,,·, \, •r,,,,,,-,m.-,,,-,,,,,mr,;·;_,,.C-C:) ·,· ... .-.,,e1,
`!,,")',,<,· .• ,,,~.,.;, 1.sr;;J1.,,v1,")·.11,.L
`pET 4 la-IDH1(1027) 1., ..• ,,.,,.,,, ,,.-d "',
`Consensu~l 027l A ('f"''T"f"'('~ ,~('~ ~']'('('(,~ 'l''T'f"'l"''l''rc:~"A'l'i:I" ,T~rT:~,c,r::1· ,Sl',.~T,~iG1,V1'-GG7 J'l',1.AiS,C.',C:C,.A1.l"_A1Sb·,1 ~~,,Ar,A,A,S.C''l' l~rf"")./t\-! I"li"l\..,,CIDll;lr:J'"\-\J l"'}:-i ('\J('\,_,'T ;crlr ,;N~·;c+'l'J'('\,_,' rcrl cr,I"' \Jr,i;i~R,t+ \J\,_, 1
`
`1135 ____________ .__ ____ - - ' - - - - ' - - - - ' - - - - ' - - - - . . _ _ _ ___. ___ _
`IDH1(CDS)(1081) :·•,,.,, ,.,,.,,.,,.,,,.,,n ')'·T;.~.()r'\Cr\A' ,r.•'7'!m'"1'/1,'';("}(,'G:'.-,"r•r•,,. '''(,',·,,,•· ', .. ·•,1'".,'\,c,,,._,,c-,,,
`-·••7 ' ,,,m,7 , - , , , •• ,,~,,."'r•m,
`pET41a-IDH1(1135)
`Conse nsu~ 1135) GAA GTCTCTATTGAGACAATTGAGGCTGGCTTCATGA CCAA GGA CTTGGCTGCTTGCATTAAAGGTTTACCCAATGTGCAACGTTCTGA CTA CTTGAATACATTTGAGTT
`(1242) _ _ _ _ .............._ _ _ _,_______............,_ _ _ .....,.__ ............... _ _ _ _ _ .............,. _ _ .......,___ _ _ _ _ _
`IDH1(CDS)(1188) G':'TCt{GG1;7;,
`pET 4 la-lDH1(1242)
`Consensu~1242) \JC H,[11\J'J[llllllll\.,C C\J\Jll\Jllrn:lll\.,Cn GJ'\AGflllfl}lf\lL"lGUlf\GlJllAl'lf\U
`
`FIG. 1
`
`Rigel Exhibit 1046
`Page 8 of 167
`
`

`

`60
`
`.70
`
`,80
`
`,90
`
`LOO
`
`11(1
`
`I 120
`
`130
`
`140
`
`.150
`
`164
`
`IDHl(CDS)
`pET41a-lDH1
`Consensus
`
`(55) 55
`(1)
`(55)
`(55) ATGTCCAAAAAAATCAGTGGCGGTTCTGTGGTAGAGATGCAAGGAGATGAAATGACACGAATCATTTGGGAATTGATTAAAGAGAAACTCATTTTTCCCTACGTGGAATT
`(163) 163
`)0
`180
`l90
`,200
`,210
`,220
`,23D
`,2 1±0
`,250
`,260
`272
`IDHl(CDS) (109)
`pET41 a-IDH 1 ( 163) ·trG:::x:.·· ;.:.<')' ·r--~ , .. !,. ...• ~·· ... T ••
`Consensus (163) TTGGATCTACATAGCTATGATTTAGGCATAGAGAATCGTGATGCCACCAACGACCAAGTCACCAAGGATGCTGCAGAAGCTATAAAGAAGCATAATGTTGGCGTCAAATG
`
`IDH!(CDS) ;:;:: :~~GC(A(·1~:~1,crcc1;,::AGMc,;i'.~:,c;,J;Ac:.;.~M,r;nC1,tj~~dBUlJ~fl~:i~i!1~/:9l~~:h!
`1~s:~ i~;~)l ;_~~~~~.~~;;;.~:.:;~;;~~;~;;;::~~~;~rI; ~;~~:~;;~:::~;;~~f ~~~;1;mu1at.ign~ijj~P;~ 1~~1~,,;~·~r
`,,,drl~A v~
`,421} 7f
`,to
`~8
`.~uu
`(379 3 lg
`,44d
`,4 0
`J9U
`;,;
`IDHl(CDS) (325) A::;AcJV~:x:cATTAI'CTGCAAAJV.\I'ATCCCCCCGCTI'GTGA::~TCGATGGCTAAAACCTATCATCATAGG:fCCJCAI'GC'l'TATCCGGAI'CMTACAGAGCAACTGATTTT::~T
`pET 41 a-lDH 1 ( 379) .i\/;J:/;Ai\GCCAT':'A '('C'.C ,:;cAAAAA '('ATCCcc,:u;c:::·;·c;1(;/l,1;rGG A':'GGCCAAMCC:::ATCATCATJi.G,:;t~JcA '('GCrTA )\;1:;t;,:;A '('CAATACAG A,:;cMC':'GATT't:::;r
`Consensus ( mi ¾P:? GAAGCCATT~$~JGCAAAA.~$ fJCCCCCG~mGTGAGT~~~JGGGTAA,~fTATCATC,%$~GGTCGTC_%J&CTTA TGG.~y~ TCAATA C.S~~GCAACTGATTT~~t
`
`pE~:~:~
`
`,
`
`IDHl(CDS) ( 433)
`pET41 a-lDH 1 ( 487) •''""'""'""cm,,,,•,cn,r<_J'. .'':"u.."•.L, ,",' crH ·"':'u"nc;in.J ; .C ·.:,n.Jr:.>. ;·cc:.-,.!. n,,:,,., ;y,_. ,.,vc-.J ; \};"\\ ''" :r·, n,. ,. ,\ 'c;:v·.;·\\:',J :
`Consensus (487l "'"'"'''"'J.W ,,\
`
`.. "" j' u00
`J,(..',~''"1 •S\J0,Arilln•c11n•J.[)):l/) .U1D\.,\., lD',.,0),,11\.,\.,l'ID'J l',J,'.,l),,\J'JD£l\.,\.,\.,[)Pfl1~'.J'J J. '.JD\.[).l/;J'v\., HJ'J Hl.',.,Q,j.,e1D\., l
`595
`--<----------------------------------
`ID H 1 (CDS) (541) 'J•.1'Cii!,'Joc·,111c,.,,icc·,·~•,1,i!.!",,.•
`pET 4 la-IDHl (595) ,, .. , ... , ..• ,, , ......
`Consensus (595) •J,J'JJH'J""'""'"'"'""'"''J"'""'"'''""'"'"'"
`:no
`(703) 703
`JDHl(CDS) (649) fo1'~,,,u . . ,,s•o,!s'J•YC,'..•_1'" > 111.'.U:!'Ch!'_,,,.,v, >
`pET 4 la·IDHl (703)
`Consensus f 703l +W+Jl.JllllJ.llS \-/S,l,+ \J'JJV,)" "l,..fAllll JCu"C,,
`1 ;'",J''"GiG(]A'Gf1Jl;iTA1 T.' ,3T~Cn'f1:.;I/y,"1'J J.n1,,nn't1--t/Y\.,\.,[1'.Jl
`811
`-::;;;::;:'.;:7,;:-:;;-;7,;::=~10"::0107~F::-::;~:::::-::;~::;::~::;:~7::~~~;:;:~~;:~::;::;::;::;:~-;::;;:;::::;::;::;:~-:;:.;-;7,;:::;::~;::;:::::~::;::0~
`IDHl(CDS) (757)
`pET 4 la-lDHl (811) ,:;AO:t,:;i;'.:'CGC:YAAGC
`~~-....._ __ ....._ __ ....._ ______________ ...,_ __ ...,_ __ ...,_ ____ _
`Consensus t811l ~;,~1;TGC;T(;G 1:~,(l;in'JI...
`919
`IDHl(CDS) (865) c:xATGATGACCA:XG
`
`._,,,yc,,!'OJ.acdllc•_\ci,.,,u!•_\c,i!'C,11',,\..i!ci•-'
`
`1
`'.'",
`
`"\-l·hl/,.l\JS•> \.,lllllli-Ml.l"
`
`812
`
`0.
`
`•S',
`
`Consensus (919) ',J\J\.,[ll'.JD.ll.lD'vlvD\.J\.,',JllJ\.,
`(1027) _10_n _ _ .......,,_10_40_........,._1o_so_........,._10_60_........,,_10_70_........,,_10_so _ _ ._10_9(_1 _........,,11_00 _ _ ,_,11_10_1 _ _ ,u_20_1 _ _ _ 11_36
`IDHl(CDS) (973)
`pET4 la-lDH1(1027) ,,,.,;.,,,i,t,,.;~,-,, o,m,,,·,.~,mcc,·,,~,c•wvn,,cm,;-,nc,,y,rm('\J,::"J ;'.:v·-"•,. ... !..i,Y•.i,J; ).;!\;',,,,_.\,. \\,;)'.,;u.J\,;!J \Cl•.l\d
`Consensu~ 1027l 'r,r,crr,r,or,r,o, crr,r,r,o '1"''1'/"1/"1''1''1'(1(\.,\',n' ';u""',1-'";'"'1 (JY,.;/"11,.,' r.r ,/,,,','(1,,,1,',n'r'Jn'('u(\.'J\J/"1'1'+~ l"w' 1
`01...r,,r,:n' 1,',n':,,,,1(,1,]\1~,n'?ci; 7,l'u1,:Tr~w1
`rn11...nn1,,;::v;\G',A(J'C''"11' ul',~'-),~~'",J' \.,r,~rc .fi'"G',.,0 ~.~1,1-,l •Cl\., l
`(1135 ~~--........ - -........ -------------------------
`ID H 1 (CDS) (1081)
`pET41a-lDH1(1135)
`Conse nsu~ 1135) GAA GTCTCTATTGAGACAATTGAGGCTGGCTTCATGA CCAA GGA CTTGGCTGCTTGCATTAAAGGTTTACCCAATGTGCAACGTTCTGA CTA CTTGAATACATTTGAGTT
`(1242) _ _ _,___ _ __.,, _ _ _.__ _ _ ...__ _______ .....,;.,., _ _ _,__ _ ___. _ _ _.,_ _ _ _,___ _ _ _
`IDH1(CDS)(1188) (t''l1CS{?;1;·rA
`pET 4 la-lDH1(1242)
`Consensu~1242) GTTCATGGATAAACTTGGAGAAAACTTGAAGATCAAACTAGCTCAGGCCAAACTTT A
`
`,:,
`
`FIG. 2
`
`Rigel Exhibit 1046
`Page 9 of 167
`
`

`

`800
`
`400
`
`150
`
`Collect
`
`.Column: 6 ml N1-Sepharose column
`
`Sample:
`
`)0ml Badena Extract
`
`Buffer A: 20 rnM Tm, pH7.4
`500 mMNaCl
`5 mM b-mercaptoethanol
`(r1 clmrnl
`l O 1
`
`1 • • •
`
`Buffer B: Buffer A
`400mM Im1dawle
`1 protease utlubitor tablet i200 ml
`
`Liner gradient ofBuffer B
`( 1 U· l U0%) in 20CV
`
`FIG. 3
`
`Rigel Exhibit 1046
`Page 10 of 167
`
`

`

`25 26 27
`
`M T I S L 17 18 19 20 21 NI 22 23 24
`
`MTISL789 WUN2 BM B67
`
`FIG. 4
`FIG.4
`
`Rigel Exhibit 1046
`Page 11 of 167
`
`Rigel Exhibit 1046
`Page 11 of 167
`
`

`

`IDHwt
`
`Column: Seplrncryl S-)1(1 (DJml)
`
`Sample: 1(1 ml IDHwt ~~mple fiorn Ni(cid:173)
`Stph;u o~e cohnnn
`
`Buffer C: 5(1 mM Tm pH
`
`5mM
`~1-m~rcaptoetkmoL
`10 1%¢ycerol
`
`FIG. SA
`
`FIG. 5B
`
`Rigel Exhibit 1046
`Page 12 of 167
`
`

`

`:r1Al.:
`
`!5DG
`
`H;Q::,
`
`5t:G
`
`#3·7
`ru~~-
`I
`I
`I
`I
`I
`I
`I
`I
`I
`I
`I
`I
`I
`I
`I
`I
`I
`I
`I
`I
`I
`I
`I
`I
`I
`I,
`I,
`I,
`I·
`
`:
`I
`I
`I
`I
`I
`I
`I
`
`•Column: 5 ml Ni-Sepharose
`
`•Sample: 30 ml Bacteria Extract
`
`•Buffer A: 50 mM Tris, pH7.4; 500
`mM NaCl; 5 mM ~
`mercaptoethanol; 10 % glycerol
`
`•Buffer B: Buffer A; 400mM
`lmidazole
`
`•Elution: liner gradient of Buffer B
`(ION 100%) in 20 CV
`
`FIG. 6
`
`Rigel Exhibit 1046
`Page 13 of 167
`
`

`

`fermentas
`Pr.~ein Milker
`
`116.0 kDa
`
`662 [la
`
`45.0 [la
`
`35.0 ~Da
`
`~%."i 18.4 [la
`
`~~\ 14.m
`
`,. ______________ i
`
`M T So
`
`In
`
`Ft : 3 4 5 6 7 1
`I
`
`I
`I
`I
`I
`I
`I
`I
`I
`I
`
`- - - - - - - - - - - - - - _I
`
`FIG. 7
`
`Rigel Exhibit 1046
`Page 14 of 167
`
`

`

`1:Si~~: :ij ~ :~~~r~
`:~i:i~~i:~#~~
`
`,~~ff~!'C: }g~1~ trn:~ lt
`iMmUit(t j:mi~~,
`:~~~~,. rntil~~
`
`FIG. SA
`
`FIG. 8B
`
`Rigel Exhibit 1046
`Page 15 of 167
`
`

`

`• •Column: 5 ml Ni-Sepharose
`
`•Sample: 30 ml Bacteria Extract
`
`•Buffer A: 50 mM Tris, pH7.4; 500 mM
`NaCl; 5 mM S -mercaptoethanol; 10 %
`glycerol; Protease Inhibitor Cocktail (Roche) 1
`tableU200 ml
`
`•Buffer B: Buffer A plus 400 mM Imidazole
`
`•Elution: liner gradient of Buffer B
`( 10~ 100%) in 20 CV
`
`FIG. 9
`
`Rigel Exhibit 1046
`Page 16 of 167
`
`

`

`T So
`
`1-------------------i
`10 1 Ni M
`In Ft M : 5 6 7 8 9
`I
`
`Fermentas
`ProteinM1rker
`\..,.,,:,;
`
`FIG. 10
`
`Rigel Exhibit 1046
`Page 17 of 167
`
`

`

`M IDHR132H
`
`~~~1 ~ i~Mm~l~(cid:173)
`~~~~·lll~~
`
`iMk1t i~rf,~.~ii~
`~m ~ ~t'J .. i~~-,
`~.~ll':l~~l, l~ i41'.~
`
`FIG. 11A
`
`FIG. 11 B
`
`Rigel Exhibit 1046
`Page 18 of 167
`
`

`

`IDH1 R132H
`
`Vmax=0.6052
`Km =171.i
`n=0.6001
`
`0.5
`
`0.4
`
`cri
`E
`f 0.3
`E t
`
`E
`::i
`; 02
`rn a:
`
`0.1
`
`0.0
`
`200
`
`400
`
`600
`
`800
`
`1000
`
`1200
`
`isocitrate (µM)
`
`FIG. 12B
`
`ICDH1 wild-type
`forward reaction
`
`Vmax=30.5
`Km:56.8
`n=1.8
`
`200
`
`400
`
`600
`
`800
`
`1000
`
`1200
`
`DL-lsocitrate (µM)
`
`FIG. 12A
`
`ICDH1 R132S
`
`Vmax:93.5
`Km= 1.125e+6
`n=0.4794
`
`35
`
`30
`
`~ 25
`0)
`~
`C E 20
`t
`E
`2 15
`Q)
`rn
`a: 10
`
`3.5
`
`3.0
`
`Q)
`
`u 2.5
`~ >
`E, 20
`
`0)
`E
`f 1.5
`~
`0
`§ 1.0
`
`0.5
`
`0 . 0 " - - - - -....... ----,,---,----,---,
`200
`400
`600
`800
`1000
`1200
`
`isocitrate (µM)
`
`FIG. 12C
`
`Rigel Exhibit 1046
`Page 19 of 167
`
`

`

`a-KG inhibition of ICDH1 wt
`
`a-KG Inhibition of ICHD1 R132H
`
`0.35
`
`0.30
`
`C
`
`01 0.25
`~
`~ 0.20
`0
`E
`2: 0.15
`Q)
`iu
`[
`;:: 0.10
`
`I =0
`•
`o I =30
`,
`I =85.3
`I =256
`V
`
`.02
`
`-0.01
`
`0.00
`
`0.01
`
`0.02
`
`0.03
`
`0.04
`
`-0.005
`
`0.000
`
`0.005
`
`0.010
`
`0.015
`
`0.020
`
`1/[isocitrate] (uM)
`
`1/[isocitrate] (uM)
`
`I =0
`•
`o I= 1167
`,
`I =3500
`
`FIG. 13A
`
`a-KG Inhibition of ICHD1 R132S
`
`FIG. 13B
`
`I =0
`•
`o I =30
`,
`I =85.3
`I =256
`V
`
`-0.005
`
`0.000
`
`0.005
`
`0.010
`
`0.015
`
`0.020
`
`1/[isocitrate] (uM)
`
`FIG. 13C
`
`Rigel Exhibit 1046
`Page 20 of 167
`
`

`

`Reverse Reaction
`a-KG to isocitrate
`
`1.6 - - - - - - - - - - - - - - - - - - - ,
`
`1.4
`
`1.2
`
`1.0
`
`0
`
`~ 8 0.8
`0
`
`0.6
`
`0.4
`
`0.2
`
`-
`
`ICDH1wt
`ICDH1 R132H
`--- ICDH1 R132S
`
`11
`" . . . .
`
`0.0 -----------.----------......-------1
`0
`200
`400
`1000
`600
`800
`
`time (sec)
`
`FIG. 14
`
`Rigel Exhibit 1046
`Page 21 of 167
`
`

`

`ICDH R132H
`Reverse Reaction
`
`ICDH R132S
`
`Vmax = 1.3
`Km= 0.9657
`n = 1.8
`
`1.4
`
`1.2
`
`,-. 1.0
`0)
`E
`"
`C
`·E o.8
`~
`E
`2, 0.6
`Ill
`1il
`CC 04
`
`0.2
`
`0.0
`
`2.5
`
`2.0
`
`o'i
`E
`"
`C 1.5
`]
`0
`E
`::i
`'a;' 1.0
`1il
`((
`
`0.5
`
`0.0
`
`Vmax = 2.7
`Km =0.1813
`Ki= 24.6
`
`10
`
`15
`
`20
`
`25
`
`10
`
`15
`
`20
`
`25
`
`[a-ketoglutarate] (mM)
`
`[a-ketoglutarate] (mM)
`
`FIG. 15A
`
`FIG. 15B
`
`Rigel Exhibit 1046
`Page 22 of 167
`
`

`

`NADH in reverse reaction
`
`~:::
`i :::
`
`~
`· ·"'""m,,.,,,.,,,,,,,.,,,.,,,",,,,,,,_,"'",,,,"<,,,,,.,, .. ,.- '
`:::: ~:O~:~: I
`
`1
`
`.0
`
`0 0.6 +------------------,---~---no enzyme
`II)
`~ 0.4
`0.2 + - - - - - - - - - - - - - I i
`l
`i
`............... =.............,.= ............... ==,..............~1
`
`~=.....,.........= ............... =
`
`0
`0
`
`100
`
`200
`
`300
`400
`Time (s)
`
`500
`
`600
`
`700
`
`FIG. 16
`
`Rigel Exhibit 1046
`Page 23 of 167
`
`

`

`Oxalomalate Inhibition of IDH1 wt
`
`Oxalomalate Inhibition of IDH R132H
`
`2.0
`
`Vmax = 31.2
`Km= 55.5
`Ki= 955.4
`
`35
`
`30
`
`Vmax = 0.5353
`Km= 84.3
`Ki= 950.8
`
`'
`
`1.5
`
`,,...,,
`Ol
`E
`' C
`.E
`' 0 1.0 E
`
`:1
`....,
`Q)
`+-'
`(lj
`a:
`'
`
`'I'"
`
`0.5
`
`' I= 0
`'
`
`0
`
`V
`
`I= 4130
`I 12390
`I= 37170
`
`V
`
`rn 25
`E
`' C
`~ 20
`0
`E
`2; 15
`Q)
`+-'
`
`(lj a:
`' 10
`
`'I'"
`
`0
`
`' I =0
`I =805
`' I =2414
`
`V
`
`I= 7242
`
`-0.02
`
`-0.01
`
`0.00
`
`0.01
`
`0.02
`
`0.03
`
`-0,02
`
`-0,01
`
`0.00
`
`0.01
`
`0.02
`
`0.03
`
`0.04
`
`0.05
`
`1/[isocitrate] (uM)
`
`FIG. 17A
`
`Oxalomalate Inhibition of IDH R132S
`
`V
`
`1/[isocitrate] (uM)
`
`FIG. 17B
`
`'
`
`0
`
`'
`
`Vmax =3.2
`Km= 211.3
`Ki =510.
`
`,,...,,
`Ol
`E
`' C
`E
`'
`] 4
`,;
`
`Q)
`+-'
`
`(lj a:
`' 'I'"
`
`' 0
`' V
`
`I =0
`I =246
`I= 737
`I =2211
`
`-0.01
`
`0.00
`
`0.01
`
`0.02
`
`0.03
`
`0.04
`
`1/[isocitrate] (uM)
`
`0.05 FIG. 17C
`
`Rigel Exhibit 1046
`Page 24 of 167
`
`

`

`7.26
`
`lirre,mn
`
`Figure 18A. LC-MS/MS analysis of the control reaction. The presence of a-KG is indicated by the peak at 7.26
`minutes (blue) while no isocitrate is observed (red).
`
`Rigel Exhibit 1046
`Page 25 of 167
`
`

`

`Max:
`
`943 987
`
`)]57
`
`1.E6
`
`i
`i
`
`.l
`:ji
`
`m1
`U.88
`
`Ii !l:r
`
`I
`
`I
`
`I
`I
`
`'
`
`I
`
`illil'i,,
`I
`I
`
`II
`1
`
`1
`
`160]
`
`150]
`
`140J
`
`130]
`
`120J
`
`110J
`
`IOOJ
`
`9[0
`
`8[0
`
`7[0
`
`6[0
`
`5[0
`
`4[0
`
`3[0
`
`2[0
`
`1.0
`
`2.0
`
`3.0
`
`4.0
`
`s.o
`
`6.0
`lirre,mn
`
`7.0
`
`s.o
`
`g.o
`
`mo
`
`no
`
`Figure 18B. LC-MS/MS analysis of the reaction containing enzyme. No isocitrate is observed (red), and a-KG has been completely
`consumed (blue).
`
`Rigel Exhibit 1046
`Page 26 of 167
`
`

`

`Max
`
`Figure 18C. LC-MS/MS analysis of the spiked control reaction. The LC-MS/MS instrument as configured can readily detect the
`presumptive final concentration of isocitrate. When the terminated R132H - containing reaction was spiked to a final
`concentration of 1 mM isocitrate, it was readily observed (red); essentially complete consumption of a-KG was confirmed (blue).
`
`Rigel Exhibit 1046
`Page 27 of 167
`
`

`

`0.52
`
`3.2e4
`
`3.0E4
`
`2.8E4
`
`2.6E4
`
`24E4
`
`2.2E4
`
`2.DE4
`
`1.8E4
`
`1.6E4
`
`14E4
`
`12E4
`
`1.0E4
`
`80[0.0
`
`Mw. 3l4[JJS
`
`7.14
`
`7.41
`
`0.5
`
`10
`
`1.5
`
`2.0
`
`2.5
`
`3.0
`
`3.5
`
`4.0
`
`4.5
`
`5.0
`
`5.5
`
`6.0
`lirre,mn
`
`6.5
`
`7.0
`
`7.5
`
`8.0
`
`85
`
`9.0
`
`9.5
`
`100 105
`
`11.0
`
`115
`
`Figure 19A. LC-MS/MS analysis of alpha-hydroxyglutarate. The instrument was optimized for the detection of 2-hydroxyglutarate and
`identified the 147.1/128.7 MRM transition as a peak retained at 7.14 minutes. The peak at 0.52 minutes is an instrument artifact
`caused by the switching of an inline diversion valve.
`
`Rigel Exhibit 1046
`Page 28 of 167
`
`

`

`5.084
`
`4.8E4
`
`4.