JmJRNAL OF BACTERIOLOGY, July 1987, p. 2950-2955
`0021-9193/87/072950-06$02.00/0
`Copyright © 1987, American Society for Microbiology
`
`Vol. 169, No. 7
`
`Analysis, Cloning, and High-Level Expression of
`2,4-Dichlorophenoxyacetate Monooxygenase Gene tfdA of
`Alcaligenes eutrophus JMP134
`WOLFGANG R. STREBER,1•2t* KENNETH N. TIMMIS,2 AND MEINHART H. ZENK1
`Lehrstuhlfur Pharmazeutische Biologie, Ludwigs-Maximilians-Universitiit, D-8000 Munich 2, Federal Republic of
`Germany, 1 and Department of Medical Biochemistry, University of Geneva, CH-1211 Geneva 4, Switzerl<iruP
`
`Received 1 December 1986/Accepted 13 April 1987
`
`Plasmid pJP4 of Alcaligenes eutrophus JMP134 contains all genes for the degradation of 2,4-
`dichlorophenoxyacetic acid (2,4-D). Five of these genes, tfdB, tfdC, tfdD, tfdE, and tfdF, have recently been
`localized and cloned (R. H. Don, A. J. Weightman, H.-J. Knac:kniuss, and I(. N. Timmis, J. Bacteriol.
`161:85-90, 1985). Gene tfd.A, which oodes for the 2,4-D monooxygenase, has now been found by inutagenesis
`with transposon TnS. A 3-kilobase fragment of pJP4 cloned in a broad-host-range vector could complement the
`2,4-D-negative phenotype of two mutants which lacked 2,4-D monooxygenase activity. The cloned tfd.A gene
`was also transferred to A. eutrophus JMP222, which is a cured derivative of JMP134. The recombinant strain
`could utilize phenoxyacetic acid as a sole source of carbon and energy. Pseudomonas sp. strain B13, containing
`the cloned tfd.A, was able to degrade phenoxyacetic acid and 4-cblorophenoxylicetic acid. Gene tfd.A was
`subcloned and analyzed by deletions. Expression of 2,4-D monooxygenase in Escherichia toll containing a
`1.4-kilobase subfragment was demonstrated by radioisotopic enzyme assay, and a protein of 32,000-dalton
`molecular mass was detected by labeling experiments. A 2-kilobase subfragment containiag tfd.A has been
`sequenced. Sequence analysis revealed an open reading frame of 861 bases which was identifted as the coding
`region of tfd.A by insertion mutagenesis.
`
`Bacteria Which degrade halogenated aromatic compounds
`are of general importance for the detoxification of pesticides
`and herbicides in nature (17). The extensive use of chlori(cid:173)
`nated phenoxyalcanoic acid herbicides in agriculture has
`induced the rapid evolution and dissemination of specific
`degradative pathways for these compounds in soil and water
`bacteria. 2,4-Dichlorophenoxyacetic acid (2,4-D) especially
`is known to be metabolized by organisms belonging to a
`variety of different bacterial genera, such as Acinetobacter,
`Alcaligenes, Arthrobacter, Corynebacterium, and Pseudo(cid:173)
`monas (4, 5, 7, 11-13, 16, 33, 35-37).
`Alcaligenes eutrophus JMP134 is one of the best(cid:173)
`characterized organisms among this group. It harbors a
`conjugative plasmid, pJP4, of about 80 kilobase (kb) size,
`which carries genes essential for the degradation cif 2,4-D,
`2-methyl-4-chlorophertoxyacetic acid, and 3-chlorobenzoic
`acid (3-CB) (7). Recently this plasmid has been isolated and
`characterized physically (8). Five genes involved in the
`degradation of 2,4-D and 3-CB have already been localized
`by transposon mutagenesis and cloned in Escherichia coli.
`Functions have been assigned to four of them by biochemi(cid:173)
`cal studies (9):
`tfdD, and
`tfdE encode
`tfdB,
`tfdC,
`2,4-dichlorophenol hydroxylase, dichlorocatechol 1,2-dioxy(cid:173)
`genase, chloromuconate cycloismherase, and chlorodiene(cid:173)
`lactone hydrolase,
`respectively. Transposon
`insertion
`mutation of gene tfdA encoding the first enzyme in 2,4-D
`degradation, which is generally designated as a monooxy(cid:173)
`genase (9, 35), could not be found in this experiment.
`Another research group, however, reported the expression
`of the ability to remove the acetate side chain from 2,4-D by
`an E. coli strain containing a cloned 21-kb Hindlll fragment
`
`* Corresponding author.
`t Present address: Institut fiir Genbiologische Forschung Berlin
`GmbH, D-1000 Berlin 33, Federal Republic of Germany.
`
`from pJP4 (1), Characterization of gene tfdA would complete
`our knowledge about the degradative functions in A.
`eutrophus JMP134 and would make it available for genetic
`engineering studies involving manipulation of microbial or(cid:173)
`ganisms to broaden their degrading capacity, or involving
`the potential use of tf dA as a gene specifying herbicide
`resistance for plants.
`We have now isolated transposon mutants of A. eutrophus
`JMP134 inactivated in 2,4-D monooxygenase and have lo(cid:173)
`calized gene tfdA by cloning and deletion analysis. We have
`shown the expression of the cloned 2,4-D monooxygenase in
`different strains, detected the corresponding protein by
`specific labeling, and determined the nucleotide sequence of
`a 2-kb fragment containing the tfdA coding region.
`
`MATERIALS AND METHODS
`Strains and plasmids. A. eutrophus JMP134 (7) contains
`plasmid pJP4 and degrades 2,4-D (Tfd+) and 3-CB (3cb+).
`Strain JMP222 is a streptomycin-resistant, pJP4-negative
`derivative of strain JMP134 and is Tfd- and 3cb- (7).
`Pseudomonas sp. strain Bl3 (10) degrades 3-CB and 4-
`chlorophenol (29). E. coli LE392 (27) was used for cloning
`experiments. E. coli HB101 (6) was the recipient for the
`conjugative transfer of mutated pJP4 derivatives. E. coli
`S17-1 (32) contains a chromosomally integrated RP4 deriva(cid:173)
`tive which is able to mobilize broad-host-rartge plasmids.
`Strain K38 ( =C600)(2) containing plasmid pOPl-2 (34) can
`express T7 RNA polymerase controlled by a heat-sensitive
`lambda repressor, and plasmids pT7-5 and pT7-6 (S. Tabor,
`unpublished data) carry the corresponding T7 promotor in
`front of a multiple cloning site. Plasmids pVKlOl (22),
`pGSS33 (30) and pKT231 (3) are mobilizable broad-host(cid:173)
`range vectors. pSUP2021 is a mobilizable plasmid carrying
`transposon Tn5 (specifies kanamycin resistance). For se(cid:173)
`quencing we used Ml3tgl30 and Ml3tgl31 (21). pDOC37 (D.
`
`2950
`
`Bayer EX1044
`
`

`

`VoL. 169, 1987
`
`2,4-D MONOOXYGENASE GENE OF A. EUTROPHUS
`
`29~51
`
`O'Connor, unpublished data) was the source of the omega
`fragment (15).
`Media and cultural conditions. A. eutrophus strains were
`grown with aeration at 30°C. PYE (7) was used as complete
`medium; liquid PYE mediunl. was supplemented with fruc(cid:173)
`tose (10 mM) when cells were grown for preparative plasmid
`isolation. Minimal medium contained (per liter): K2HPO4,
`1.6 g; KH2PO4, 0.4 g; (NH4)iSO4, 1.0 g; MgSO4 · 7i::IiO, 0.05
`g; and FeSO4 • 7H2O, 0.01 g. Carbon sources were added to
`the following final concentrations: 2,4-D, 1 mM; 3-CB, 2
`mM; 4-chlorophenoxyacetic acid, 1 mM; phenoxyacetic acid
`(PAA), 4 mM; fructose, 10 mM; and sodium pyruvate, 15
`mM. Matings on solid medium were done on PYE agar
`plates (7). E. coli strains wete grown in LB medium (25) at
`37°C if not otherwise specified. Antibiotics Were incorpo(cid:173)
`rated at the following concentrations: ampicillin, 50 µ.g/ml;
`chloramphenicol, 20 µ.g/ml; kanamycin, 50 µ.g/ml; strepto(cid:173)
`mycin, 25 µ.g/ml; and spectinomycin, 80 µ.g/ml.
`Conjugative crosses. For transposon niutagenesis, donor
`and recipient cells were grown in liquid culture to the late
`exponential phase and mixed in a 1: 1 ratio relative to their
`optical density. Samples of 1. 5 ml of the mixture were spread
`onto PYE plates and incubated overnight at 30°C. Plate
`surfaces were then washed with 0.7% NaCl solution, the cell
`suspension was diluted, and samples were spread onto
`selective plates.
`For complementation tests, mutant strains were grown
`overnight in liquid culture and spread onto 2,4-D minimal
`plates, and donor strains were streaked onto plate surfaces.
`Conjugation and selection were simultaneously done by
`incubation at 30°C for 14 days.
`For all other conjugations, cells were grown in liquid
`culture overnight, mixed, and spotted onto PYE plates.
`After incubation at 30°C for 4 to 6 h, cells were suspended in
`0.7% NaCl solution, diluted, and spread onto selective
`plates.
`Transposon mutagenesis. The mobilizable transposon car(cid:173)
`rier plasmid pSUP2021 (32) was transferred by conjugation
`from the mobilizing donor strain E. coli S17-1 (32) to A.
`eut'rophus JMP134. Transconjugants were selected from
`mating mixture on fructose minimal medium containing 380
`µ,g of kanamycin per ml and substiquently screened for loss
`of 2,4-D degradative ability by replica plating on minimal
`medium containing 2,4-D as the single carbon source. The
`absence of degradative functions Was also verified by testing
`on 2,4-D indicator medium (24).
`Oxygen uptake assays. A. eutrophus wild-type or mutant
`strains were grown overnight in 250 ml of minimal medium
`containing 15 mM sodium pyruvate, For induction of 2,4-D(cid:173)
`degradative genes, the same medium was used with addition
`of 3-CB to a final concentration of 1 mM (9). Cells were
`harvested by centrifugation at 4°C, washed three times in
`cold minimal medium without carbon source, and finally
`suspended in a portion of minimal medium to an optical
`density at 420 nm (A420) of 30.
`For assay of 2,4-D monooxygenas~ or 2,4-dichlorophenol
`hydroxy lase activity, 1 volume of cell suspension was mixed
`with 9 volumes of minimal tnedium saturated with oxygen to
`yield an A420 of 3, and background level of oxygen uptake
`was determined for 10 min. Then substrate was added to a
`final concentration of 1 mM 2,4-D, 1 mM PAA, or 0.2 mM
`2,4-dichlorophenol, and linear decrease of oxygen concen(cid:173)
`tration was measured over 20 min.
`Preparative plasmid isolation. Plasmid pJP4 and transpo(cid:173)
`son Tn5 containing derivatives of pJP4 were isolated from A.
`eutrophus by the procedure of Hansen and Olsen (18).
`
`Plasmids from E. coli were prepared by the alkaline lysis
`method described by Maniatis et al. (25).
`Radioisotopic 2,4-D assay. For the assay of 2,4-D
`monooxygenase in E. coli, cells of strain K38 containing
`both pGPl-2 and the pT7 recombinant plasmid were induced
`for overproduction of erizyme. They were grown at 30°C in
`20 ml of LB medium under ampicillin and kanamycin selec(cid:173)
`tion. At an A590 of 1.0 the temperature was raised to 42°C for
`25 min, ruampin was added to a final concentration of 100
`µ.g/ml, and cells were shaken for 2 h at 37°C. Harvesting,
`washing, and incubation followed the protocol given by Amy
`et al. (1) with the following modifications: 20 ml of cell
`suspension was incubated with 0.1 µ.Ci of 14C-labeled 2,4-D
`in a 250-ml Warburg flask, which was closed with a tapered
`glass stopper and a serum stopper. A 0.5-ml volume of
`beta-phenylethylamihe was placed in the central vial, and 2
`ml of 1 N H2SO4 was injected into the surrounding cell
`suspension. After 1 h of gentle shaking, the trapped 14CO2
`was eluted from the central vial with 5 ml of Rotiszint 22
`(Roth GmbH & Co. Chemische Fabrik, Karlsruhe, Federal
`Republic of Germany) and counted for radioactivity.
`Radioactive labeling of plasmid-encoded proteins. The fol(cid:173)
`lowing protocol was received from Stan Tabor (ltarvard
`Medical School, Boston, Mass.). Cells of E. coli K38 con(cid:173)
`taining both pGPl-2 and the pT7-recombinant plasmid were
`grown in LB medium under ampicillin and kanamycin selec(cid:173)
`tion. At an A 590 of 0.5, 0.2 ml of cells was centrifuged,
`washed in 5 ml of M9 medium (25), recentrifuged, and
`suspended in 1.0 ml of M9 medium supplemented with 20 µ.g
`of thiamine per ml and 18 proteinogenic amino acids (each
`0.01%, without cysteine and methionine). The cells were
`shaken at 30°C for 60 min, and then the temperature was
`increased to 42°C. After 15 min, 10 µ.l of a rlfampin stock
`solution (20 mg/ml in methanol) was added to a final concen(cid:173)
`tration of 200 µ.g/ml, and the cells were left at 42°C for 10
`min. Thereafter the temperature was decreased to 30°C for
`20 min, and samples Were then pulsed with 10 µ.Ci of
`L-[35S]methionine (Arnersham; cell labeling grade) for 5 min
`at room temperature and centrifuged. The cell pellet was
`suspended in 120 µ.l of cracking buffer (60 mM Tris hydro(cid:173)
`chloride, pH 6.8, 1% sodium dodecyl sulfate [SOS], 1%
`2-mercaptoethanol, 10% glycerol, 0.01% bromophenol blue).
`The samples were heated to 95°C for 3 min and loaded onto
`an SDS-polyacrylamide gel as described by Laemmli (23).
`
`RESULTS
`Transposon mutants of pJP4. Of 1,000 kanamycin-resistant
`clones which had Tn5 stably integrated in their genome, we
`isolated 8 mutants that were unable to grow on 2,4-D. All of
`these strains carried the transposon on plasmid pJP4, as
`determined by conjugative transfer of kanamycin resistance
`to E. coli HBlOl and A. eutrophus JMP222. Four 2,4-D(cid:173)
`mutants were still able to grow on 3-CB, thus belonging to
`mutant class A, B, or F, as described by Don et al. (9). To
`determine the specific enzyrrie defects, oxygen uptake of
`these strains was measured during incubation of whole cells
`with 2,4-D and 2,4-dichlorophenol as substrates. Two mu(cid:173)
`tant strains were deficient in 2,4-D monooxygenase activity,
`whereas their 2,4-dichlorophenol hydroxylase was still ac(cid:173)
`tive when 3·CB was used as an inducer. This fact assigns
`these strains to mutant class A.
`Restriction mapping of pJP4 derivatives of tfdA mutants
`showed that in addition to insertion of Tn5, large deletions or
`rearrangements had occurred which involved EcoRI frag(cid:173)
`ments C, E, G, H, and I. Because of their complexity they
`could not be physically characterized further.
`
`Bayer EX1044
`
`

`

`2952
`
`STREBER ET AL.
`
`J. BACTERIOL.
`
`Cloning of tfdA. We first cloned the 21-kilobase HindIII
`fragment of pJP4 in pVKlOl. A restriction map of the
`fragll\ent is shown in Fig. 1. The recombinant plasmid
`pVJH21 was transferred by direct conjugation on selective
`medium to t/dA-defective transposon mutants, using E. coli
`S17-1 as a mobilizing donor strain. Colonies appeared in
`mating experiments on 2,4-D medium after 14 days and
`showed wild-type growth. The system was further used to
`test subcloned fragments for complementation or marker
`rescue of Tn5 mutants. Sacl fragments from pVJH21 were
`shotgun-ligated with the broad-host-range vector plasmid
`pGSS33, and E. coli LE392 was transformed with the DNA.
`Recombinant plasmids were isolated, identified, brought into
`strain S17-1 by transformation, and subsequently transferred
`to the transposon mutants. Plasmids such as pGJS3 contain(cid:173)
`ing a 3-kilobase Sacl fragment ofpJP4/pV1H21 were abJe to
`restore 2,4-D metabolism in both mutants.
`Expression in A. eatrophus JMP222. Strain JMP222 is able
`to grow on phenol as a carbon source by using chromoso(cid:173)
`mally located genes for a meta-cleavage pathway, but cannot
`grow on PAA. On the other hand, we know from oxygen
`uptake assays with induced cultures of strain JMP134 that
`the ifdA-encoded 2,4-D monooxygenase can also convert
`
`1kb
`........
`
`\
`
`\
`
`\
`
`\ - \
`growth on
`phenoxyacetic
`u= o
`ii:
`acid:
`-a §
`~
`CJc, UJU
`..,
`... I I...._ ..... I _ _._I __,l.____,I pKJS31/32 +
`II) II)
`II)
`0
`C,
`(/)
`
`FJG. 2. Expression of gene tfdA by T7 RNA polymerase. Three
`DNA fragments able to confer PAA degradation on A. eutrophus
`JMP222 (1, 2.8-kb Sacl-SaU; 2, 2.1-kb BamHl-SaU; 3, 1.4-kb
`Xbal-SaU) were cloned in T7 promoter plasmids pTI-5 (A) and
`pTI-6 (B), yielding constructions with both orientations of the jnsert
`in relation to the T7 promoter. Strains of E.coli K38 carrying a
`heat-inducible T7 RNA polymerase gene on plasmid pGPl-2 and one
`of the hybrid pTI plasmids were used for specific labeling of
`plasmid-encoded proteins: gene expression was induced by heat, the
`host RNA polymerase was inhibited with rifampin, and cells were
`pulsed with L-(35S]methionine as described in Materials and Meth(cid:173)
`ods Oanes b). For labeling of total cell protein, samples were treate~
`omitting both heat induction and rifampin addition (lanes a). Pro(cid:173)
`teins were separated by electrophoresis on a 12.5% SDS(cid:173)
`polyacrylamide gel and revealed by autoradiography. Transcription
`from the Xbal to the Sall site resulted in expression of a 32,000-
`dalton protein (panel A), whereas no protein was expressed from
`opposite orientations (panel B). M, Molecull!I' weight markers
`(transferred from Coomassie blue-stained gel).
`
`unsubstituted PAA to phenol. Thus, growth on PAA was
`chosen as a test for expression of ifdA in strain JMP222. The
`3-kb Sacl fragment was subcloned by using the broad-host(cid:173)
`range vector pKT231, and hybrid plasmids pKJS31 and
`pKJS32 (inserts in opposite orientations) were subsequently
`mobilized from E. coli S17-1 to A. eutrophus JMP222.
`Colonies growing on PAA (Paa+) appeared after 3 to 4 days;
`no difference was observed in the behavior of clones carry(cid:173)
`ing the different hybrid plasmids. All tested Paa+ colonies
`were kanamycin resistant, whereas from colonies selected
`on kanamycin several had lost the ability to grow on PAA.
`Expression in Pseudomonas sp. strain B13. As the side(cid:173)
`chain cleavage enzyme encoded by ifdA accepts diiferently
`substituted and unsubstituted PAAs as substrates, we sup(cid:173)
`posed that introduction of tfdA into Pseudomonas sp. strain
`B13, which is able to degrade 4-chlorophenol (29), could
`extend the degradative capacity of strain B13 to 4-
`chlorophenoxyacetic acid. Plasmids pKJS31 and pKJS32
`were transferred by conjugation from E. coli S17-1 to Pseu(cid:173)
`domonas sp. strain B13. As expected, transconjugants were
`able to grow on 4-chlorophenoxyacetic acid, and, in addi(cid:173)
`tion, they could also use PAA as a growth substrate.
`Deletion analysis. We used the growth of strain JMP222 on
`PAA as an appropriate system to test constructions with
`several deletions for the expression of tfdA. Small DNA
`fragments were deleted between unique restriction sites on
`pKT231 and the Sacl insert. Up to the Xbal site from one
`
`Bayer EX1044
`
`\
`
`\
`
`\
`
`:I:
`
`..,
`CD
`
`J:I
`X
`
`C,
`
`.Q f
`
`pKJS(X)630 +
`
`u
`C,
`(/)
`
`pKJS32RH6S' +
`
`I
`
`ci
`(/)
`
`-a:::
`
`-:I:
`
`E
`0 u
`C,
`CD
`UJ
`I
`I
`pKJE68130
`FIG. 1. Cloning and deletion analysis of tfdA. Hybrid plasmids
`containing fragments of pJP4 cloned in broad-host-range vector
`pKT231 were transferred from E. coli S17-1 to A. eutrophus JMP222
`by conjugation. Transconjugants carrying an intact tfdA gene were
`able to grow on PAA as a carbon source. The localization of tfdA on
`pJP4 is indicated by the solid triangle.
`
`

`

`VOL. 169, 1987
`
`2,4-D MONOOXYGENASE GENE OF A. EUTROPHUS
`
`2953
`
`60
`30
`,
`CCATCCTCTCTCACCTCGCGCGCAATGCTCGAACCCGCTGCGATATACAGCCGTTCGTAG
`
`120
`90
`,
`TCCAGGTGCTCCACCGTGATTCCAGGCTCCTCGGGGTACAAGCGGCCGACACCGAGATGG
`
`180
`150
`,
`ATGGTGCCGGCACGCAGGGCCTCGATCTGCCGCACCTTGGGCATCAGGGCCAGAGACACC
`
`240
`210
`CTCGCCCCCGGGACCGCCTGCGTGAACGCATGGAGCAATGCCGGGACGGTCTGGTAGATC
`
`300
`270
`GCCGTGCCGAGGTAGCCGATATCGAGTTGGCCGATCTCGCCCCGGCTGGCGGCGCGGGAC
`
`360
`330
`CGGTCCACGGAAGTCCGACCCAGTTCGAGCATGCGCCGTGCATCTTCGAGAAACGCGGCC
`
`420
`390
`CCGGCGGGCGTGAGCTGCACGCCGCGCGCGCTGCCCTCGAACAACAACACGCCCAGATGC
`
`480
`450
`TGTTCGAGCGCGTGAATCTGTCGCGTGACCGGCGGCTGGGAAATATGCAGCCGCCGCCCG
`
`540
`510
`,
`CCGGCACCGACGTTGCCCTCCTCCGCGGCAGCAACGAAATAGCGAAGCTGTCGAAACTCC
`
`600
`570
`ATTCTTCACTCCTGCTGGCTGGCTCCCGCTGCCGGACACCCATACCGATCCCGTATCCCT
`Xbol
`660
`630
`CGCGCTGATGGAAGGTATTAGACCATATGGCCCGGCATT'i'c"fAGi:CTACCGCCATGATAA
`
`720
`690
`AACTCGGCTGCTCTCTCGTCTGCTGGAACATCTTCAGGCGCGCTGAGCCGTCTTTTTGAA
`
`780
`•
`•
`750
`•
`.
`ACAGTCTCTTAGA~AAAAAACTGAGCGTCGTCGCAAATCCCCTTCATCCTCTT
`SerValValAlaAsnProLeuBisProLeu
`
`840
`810
`.
`TTCGCCGCAGGGGTCGAAGACATCGACCTTCGAGAGGCCTTGGGTTCGACCGAGCTCCGA
`PbeAlaAlaGlyValGluAaplleAspLeuArgGluAlaLeuGlySerTbrGluValAr1
`
`900
`870
`.
`GAGATCGAACGGCTAATGGACGAGAAGTCGGTGCTGGTGTTCCGGGGGCAGCCCCTGAGT
`GlulleGluAr1LeuMetAspGluLyaSerValLeuValPbeAr1GlyGlnProLeuSer
`"o
`.
`.
`.
`960
`CAGGATCAGCAGATCGCCTTCGCGCGCAATTTCGGGCCACTCGAAGGCGGTTTCATCAAG
`GlnAspGlnGlnlleAlaPbeAlaAr1AanPbeGlyProLeuGluGl1GlyPhelleLya
`
`990
`1020
`•
`GTCAATCAAAGACCTTCGAGATTCAAGTACGCGGAGTTGGCGGACATCTCGAACGTCAGT
`YalAsaGlaAr1ProSerAr1PheLyaTyrAlaGluLeuAlaAaplleSerAanValSer
`
`1080
`•
`•
`1050
`CTCGACGGCAAGGTCGCGCAACGCGATGCGCGCGAGGTGGTCGGGAACTTCGCGAACCAG
`LeuAapGlyLysValAlaGlnAr1AapAlaAr1Glu9al9alGlyAanPheAlaAsaGla
`
`1140
`1110
`•
`•
`CTCTGGCACAGCGACAGCTCCTTTCAGCAACCTGCTGCCCGCTACTCGATGCTCTCCGCG
`LeuTrpRisSerAspSerSerPheGlnGlnProAlaAlaArgTyrSerMetLeuSerAla
`
`1200
`1170
`•
`•
`GTGGTGGTTCCGCCGTCGGGCGCCGACACCGAGTTCTGCGACATGCGTGCGGCATACGAC
`ValVnlValProProSerGlyGlyAspTbrGluPbeCysAspMetArgAlaAlaTyrAsp
`
`1260
`1230
`•
`•
`GCGCTGCCTCGGGACCTCCAATCCGAGTTGGAAGGGCTCCGTGCCGAGCACTACGCACTG
`AlaLeuProArgAspLeuGlaSerGluLeuGluGlyLeuArgAlaGluRisTyrAlaLeu
`
`1320
`1290
`.
`.
`AACTCCCGCTTCCTGCTCGGCGACACCGACTATTCGGAAGCGCAACGCAATCCCATGCCG
`AsaSerArgPbeLeuLeuGlyAspThrAspTyrSerGluAlaGlaArgAsnAlaMetPro
`
`1380
`1350
`•
`•
`CCGGTCAACTGGCCGCTGGTTCGAACCCACGCCGGCTCCGGGCGCAAGTTTCTCTTCATC
`ProValAsnTrpProLeuValArgTbrBisAlaGlySerGlyArgLysPbeLeuPhelle
`
`1440
`1410
`.
`.
`.
`GGCGCGCACGCGAGCCACGTCGAAGGCCTTCCGGTGGCCGAAGGCCGGATGCTGCTTGCG
`GlyAlaBisAlaSerBisYalGluGlyLeuProYalAlaGluGlyArgMetLeuLeuAla
`EcoRI
`.
`.
`.
`.
`Bglll
`GAGCTTCTCGAGCACGCGACACAGCGGliifficGTGTACCGGCATCGCTCGAACGTGGGM
`GluLeuLeuGluRisAlaThrGlaArgGluPbeValTyrArgBisArgTrpAsnYalGly
`
`1560
`•
`•
`1530
`.
`•
`fficTGGTGATGTGGGACAACCGCTGCGTTCTTCACCGCGGACGCAGGTACGACATCTCG
`AspLeuYnlMetTrpAspAsnArgCysValLeuHisArgGlyArgArgTyrAsplleSer
`
`1620
`1590
`•
`•
`GCCAGGCGTGAGCTGCGCCGGGCGACCACCCTGGACGATGCCGTCGTCTAGCGCACGCCA
`AlaArgArgGluLeuArgArgAlaTbrTbrLeuAspAspAlaValYalKnd
`
`1680
`1650
`.
`.
`TGGCGCACGCCCTTTTCCCGAAGGCCCCACAAGATGTACGCAACCCTGATCAGCGGCAGC
`
`1740
`1710
`•
`•
`CGTAGCCTGGACGGCGACACCTTGGCGCAGCGCGTCCTTCGAGCGGCGGGCGGCCTGGCG
`
`1800
`1770
`•
`•
`GCATGGGGATTGAGGCCCGGTGATGTCGTCGCCATCCTCATGCGCAATGACTTTCCGGTG
`
`1860
`1830
`CTCGAAATGACGCTGGCCGCGAACCGCGCCGGCATCGTTGCGGTGCCTTTGAACTGGCAT
`
`1920
`•
`1890
`GCGAACCGGGACGAGATCGCCTTCATCCTCGAGGACTGCAAAGCGCGTGTGCTCGTCGCG
`
`1980
`•
`•
`1950
`CACACCGATCTGCTCAAGGGCGTTGCATCCGCGGTGCCCGAGGCCTGCAAGGTGCTGGAA
`
`2040
`•
`•
`2010
`GCCGCGTCGCCGCCCGAGATCCGGCAGGCCTATCGCCTGTCCGATGCGTCGTGCACGGCG
`
`AACCCGGGCACGGTCGAC
`
`FIG. 3. Nucleotide sequence of the 2.06-kb BamHI-Sall fragment of pJP4 encoding the 2,4-D monooxygenase gene tfdA. The coding
`strand of the DNA is presented in the 5'-to-3' direction along with the deduced amino acid sequence of the only possible open reading frame.
`The Bglll cleavage site where the omega fragment was inserted is indicated at nucleotide 1500. A putative Shine-Dalgamo sequence in front
`of the coding region is enclosed in a box.
`
`end and to the Sall site from the other end, deletions could
`be made without loss of degradative activity (Fig. 1),
`whereas deletion of the smaller EcoRI-Sacl fragment re(cid:173)
`sulted in inactivation of tfdA.
`Specific labeling of tfdA gene product. All fragments able to
`confer PAA degradation on strain JMP222 were subcloned
`from pKT231 in T7 RNA polymerase-promoter plasmids
`pT7-5 and pT7-6, yielding constructions with both orienta(cid:173)
`tions of the insert in relation to the promoter. Plasmid(cid:173)
`encoded proteins were labeled with L-[35S]methionine,
`separated by SDS-polyacrylamide gel electrophoresis, and
`revealed by autoradiography. Figure 2 shows the expression
`of a single protein from all constructions in which the T7
`RNA polymerase reads from the Xbal to the Sall restriction
`site. The protein molecular weight was determined to be
`about 32,000 by comparison with standard protein markers.
`Expression of 2,4-D monooxygenase in E. coli. pTJS'X535
`is a hybrid plasmid of pT7-5 and the Sall-Xbal fragment of
`pJP4 (Fig. 1). E. coli K38, containing both pGPl-2 and
`pTJS'X535, was able to release 14CO2 from 2,4-D labeled in
`
`position 2 of the acetate side chain. Kinetic assays show that
`70% of total trapped radioactivity is released within the first
`hour of incubation, thus indicating a high level of expression
`of 2,4-D monooxygenase from the T7 RNA promoter.
`Nucleotide sequence of the cloned tfdA DNA. The 2.8-kb
`Sacl-Sall fragment shown in Fig. 1 was subcloned in repli(cid:173)
`cative forms of both phages M13tg130 and M13tg131. To
`create a series of deletions for primed dideoxynucleotide
`sequencing, unidirectional digestion with exonuclease III
`was carried out by the method of Henikoff (20). For this
`purpose, recombinants from M13tg130 were cleaved by Sall
`and Pstl, whereas recombinants from M13tgl31 were
`cleaved by Sacl and BamHI. Clones containing plasmids
`with deletions were analyzed by restriction endonuclease
`cleavage of replicative forms, and appropriate deletions
`were chosen for sequencing. The nucleotide sequence was
`determined by the method of Sanger et al. (28).
`Translation of the sequence shown in Fig. 3, from the
`Xbal to the Sall site where tfdA gene activity is expressed,
`reveals one possible open reading frame which corresponds
`
`Bayer EX1044
`
`

`

`2954
`
`STREBER ET AL.
`
`J. BACTERIOL.
`
`in its length to a protein size of 32,000 as determined from
`electrophoresis of labeled tf dA gene product.
`Insertion mutagenesis of cloned tfdA. As 2,4-D mono(cid:173)
`oxygenase activity was directly correlated with expression
`of a protein of 32,000 molecular weight and with presence of
`an intact open reading frame of 861 base pairs, we assumed
`that insertion of transcriptional and translational stop signals
`at a Bg/11 site situated within this reading frame would result
`in expression of a truncated protein and in inactivation of
`2,4-D monooxygenase. We excised the omega fragment from
`pDOC37 with BamHI and inserted it into a Bg/11-cleaved
`pTJS'X535. Specific labeling by the method of Tabor and
`Richardson (34) as described above revealed a protein of
`29,000 molecular weight (Fig. 4), which matches the pre(cid:173)
`dicted size calculated from a shortened open reading frame
`of 768 base pairs. No enzymatically active 2,4-D mono(cid:173)
`oxygenase was expressed from the omega-mutagenized plas(cid:173)
`mid, as shown by radioisotopic 2,4-D assay (Table 1).
`
`DISCUSSION
`
`In this report we describe the cloning and characterization
`of gene tfdA from A. eutrophus JMP134, which encodes the
`first enzymatic step in the degradation of 2,4-D. The identity
`of the cloned gene was confirmed by the following criteria:
`(i) complementation of tfdA-defective transposon mutants;
`(ii) expression of PAA degradative capacity in A. eutrophus
`JMP222; and (iii) expression of 2,4-D side chain cleavage in
`E.coli.
`We have identified the protein encoded by tfdA, and we
`have determined the nucleotide sequence of the cloned gene.
`One possible open reading frame was found, which starts at
`base 748 with a GTG codon and ends at base 1608 in front of
`
`FIG. 4. Omega mutagenesis of gene tfdA. The omega fragment,
`which carries transcriptional and translational stop signals, was
`inserted at a Bgfll site situated within the coding region of tfdA on
`plasmid pTJS'X535. Gene expression was induced using the T7
`RNA polymerase-promoter system. Protein was labeled with L(cid:173)
`[35S]methionine, loaded onto a 12.5% SDS-polyacrylamide gel,
`and revealed by autoradiography. No protein is expressed from
`the vector plasmid pT7-5 (lanes 1). A truncated tfdA gene prod(cid:173)
`uct
`is expressed
`from both omega-mutagenized plasmids
`pTJS'X535omega (lanes 2 and 4), whereas a full-length protein is
`expressed from pTJS'X535 (lanes 3). Samples were labeled after
`heat induction and addition of rifampin (lanes b) or omitting induc(cid:173)
`tion and rifampin addition (lanes a).
`
`Plasmid
`
`Open reading
`frame,.
`(base pairs)
`
`TABLE 1. Correlation of 2,4-D monooxygenase activity, protein
`length, protein length, and open reading frames in a tfdA-pT7
`hybrid plasmid and its insertion derivative
`Enzyme
`Mol mass of
`proteinb
`activity"
`(kcpm)
`(daltons)
`pT7-5
`0.3
`70
`pTJS'X535
`0.4
`pTJS'X535omega
`" Measured release of 14C02 .
`b Determined by SDS-polyacrylamide gel electrophoresis.
`c From GTG (base 748) to first in-frame stop.
`
`32,000
`29.000
`
`861
`768
`
`a TAG stop codon. The translational start was confirmed by
`determination of the first 16 N-terminal amino acids of the
`purified protein (data not shown). Upstream of base 748, a
`Shine-Dalgarno sequence can be identified (base 735). Esti(cid:173)
`mation of a molecular weight of 31,000 to 33,000 for the tfdA
`gene product by SDS-polyacrylamide gel electrophoresis is
`in agreement with the molecular weight of 32,171 predicted
`from the 861-nucleotide open reading frame. Functional
`correlation of the nucleotide sequence and enzyme activity
`has been shown by insertion mutagenesis.
`It is now of interest to elucidate the regulation of 2,4-D
`degradation in strain JMP134. The promoter which is obvi(cid:173)
`ously present on the cloned tf dA fragment could serve as a
`tool for the search of a regulatory gene. Sequence analysis
`shows an AT-rich area upstream of the coding region, and
`insertion of a DNA fragment into the XbaI site results in
`poor expression of tfdA if a foreign promoter is not provided
`on the insert (data not shown). Promoter structures can
`therefore be expected around that area.
`Interestingly, gene tf dA is located at a distance of 13 kb
`from the gene cluster encoding the hydroxylation and meta(cid:173)
`cleavage of 2,4-dichlorophenol. A similar separation of cat(cid:173)
`abolic genes into upper and lower pathway gene clusters has
`also been observed on the NAH (naphthalene degradation)
`plasmid (39) and the TOL (toluene degradation) plasmid (14).
`This finding provides additional support for the "module"
`theory, which postulates an evolution of degradative path(cid:173)
`ways by sequential assembly of distinct parts of the pathway
`(14). Together with conjugation, this provides gram-negative
`bacteria with an enormous flexibility for the evolution of new
`degradative functions.
`Another trait which gene tf dA has in common with other
`catabolic genes is the broad substrate specificity of the
`encoded enzyme. It is able to use 2,4-D, 2-methyl-4-
`chlorophenoxyacetic acid, 4-chlorophenoxyacetic acid, and
`PAA as substrates. A variety of related compounds which
`have not yet been tested may perhaps be metabolized as
`well. Similar broad specificities have been demonstrated for
`xylene oxidase (19, 26). We can expect therefore that the
`cloned tf dA gene will be useful in the construction of novel
`pathways. Potential uses of gene tfdA may be seen not only
`in the field of bacterial degradative functions, but also in
`genetic engineering of plants. The metabolism of 2,4-D by
`some plant species has already been reported (31, 38). We
`achieved tolerance of a Nicotiana silvestris haploid cell
`suspension culture against 2,4-D by adapting it to higher
`concentrations of the synthetic growth hormone (40). As
`gene tfdA specifies the side chain cleavage of 2,4-D, the
`capacity of plant cells to detoxify chlorinated PAA herbi(cid:173)
`cides could be increased by the transformation of cells with
`tfdA, followed by expression of an enzymatically active
`protein. Thus, another bacterial gene would be available, in
`
`Bayer EX1044
`
`

`

`VOL. 169, 1987
`
`2,4-D MONOOXYGENASE GENE OF A. EUTROPHUS
`
`2955
`
`addition to the prevalently used neomycin phosphotransfer(cid:173)
`ase gene, to function as a selectable marker gene for plant
`genetic experiments, and perhaps transformed cells can be
`regenerated to whole, herbicide-resistant plants.
`
`ACKNOWLEDGMENTS
`
`We are grateful to R. H. Don, S. Harayama, A. Bock, and B.
`Friedrich for the helpful discussion of our work, to H. G. Schlegel,
`G. S. Sharpe, A. Piihler, and S. Tabor for kind gifts of bacterial
`strains and plasmids, and to F. Lottspeich for determination of the
`amino acid sequence.
`This research was supported by grants to M.H.Z. and to H.-J.
`Knackmuss and K.N.T. from the Bundesministerium fiir Forschung
`und Technologie, Bonn, Federal Republic of Germany.
`
`LITERATURE CITED
`1. Amy, P. S., J. W. Schulke, L. M. Frazier, and R. J. Seidler.
`1985. Characterization of aquatic bacteria and cloning of genes
`specifying partial degradation of 2,4-dichlorophenoxyacetic
`acid. Appl. Environ. Microbiol. 49:1237-1245.
`2. Appleyard, R. K. 1954. Segregation of new lysogenic types
`during growth of a doubly lysogenic strain derived from Esch(cid:173)
`erichia coli Kl2. Genetics 39:440-452.
`3. Bagdasarian, M., and K. N. Timmis. 1982. Host:vector systems
`for gene cloning in Pseudomonas. Curr. Top. Microbiol. Immu(cid:173)
`nol. 96:47-67.
`4. Bell, G. R. 1957. Some morphological and biochemical charac(cid:173)
`teristics of a soil bacterium which decomposes 2,4-dichloro(cid:173)
`phenoxyacetic acid. Can. J. Microbiol. 3:821-840.
`5. Rollag, J. M., C. S. Helling, an