Jia et al. BMC Cell Biology 2014, 15:16
`http://www.biomedcentral.com/1471-2121/15/16
`
`R E S E A R C H A R T I C L E
`
`Open Access
`
`FAP-α (Fibroblast activation protein-α) is involved
`in the control of human breast cancer cell line
`growth and motility via the FAK pathway
`Jun Jia1,2*, Tracey Amanda Martin1*, Lin Ye1 and Wen Guo Jiang1
`
`Abstract
`Background: Fibroblast Activation Protein alpha (FAP-α) or seprase is an integral membrane serine peptidase.
`Previous work has not satisfactorily explained both the suppression and promotion effects that have been observed
`in cancer. The purpose of this work was to investigate the role of FAP-α in human breast cancer. Expression of
`FAP-α was characterized in primary tumour samples and in cell lines, along with the effects of FAP-α expression
`on in vitro growth, invasion, attachment and migration. Furthermore the potential interaction of FAP-α with other
`signalling pathways was investigated.
`Results: FAP-α was significantly increased in patients with poor outcome and survival. In vitro results showed that
`breast cancer cells over expressing FAP-α had increased growth ability and impaired migratory ability. The growth
`of MDA-MB-231 cells and the adhesion and invasion ability of both MCF-7 cells and MDA-MB-231 cells were not
`dramatically influenced by FAP-α expression. Over-expression of FAP-α resulted in a reduction of phosphorylated
`focal adhesion kinase (FAK) level in both cells cultured in normal media and serum-free media. An inhibitor to FAK
`restored the reduced motility ability of both MCF-7exp cells and MDA-MB-231exp cells and prevented the change
`in phosphorylated FAK levels. However, inhibitors to PI3K, ERK, PLCϒ, NWASP, ARP2/3, and ROCK had no influence this.
`Conclusions: FAP-α in significantly associated with poor outcome in patients with breast cancer. In vitro, FAP-α
`promotes proliferation and inhibits migration of breast cancer cells, potentially by regulating the FAK pathway. These
`results suggest FAP-α could be a target for future therapies.
`Keywords: FAP-α, FAK, Breast Cancer, Growth, Migration
`
`Background
`Fibroblast Activation Protein alpha (FAP-α) or Seprase is
`a member of the serine integral membrane peptidases
`(SIMPs) family which also includes prolylendopeptidase,
`dipeptidyl peptidase IV (DPPIV or CD26), and dipeptidyl
`peptidase IIX. These peptidases are inducible, specific
`for proline-containing peptides, and are active on the
`cell surface [1,2]. Previous studies have demonstrated
`that FAP-α has an important role in development of
`cancers by modifying bioactive of substrate peptides and
`their cellular functions. However, the tissue distribution
`and function of FAP-α remains unclear.
`
`* Correspondence: vm26jun@gmail.com; martinta1@cf.ac.uk
`1Cardiff University-Peking University Cancer Institute, Cardiff University School
`of Medicine, Cardiff CF14 4XNWales, UK
`2The Breast Oncology Department, Beijing Cancer Hospital, Peking University
`School of Oncology, Beijing 100142, China
`
`FAP-α has been shown to be transiently expressed in cer-
`tain normal fetal mesenchymal tissues, during wound heal-
`ing and in reactive stroma responding to most o sarcomas
`and epithelial cancers including breast cancer, oesophageal
`cancer, colon cancer, pancreatic adenocarcinoma [3-6].
`Normal adult tissues, haematopoietic cells as well as ma-
`lignant epithelial cells are generally FAP-α -negative. How-
`ever other studies have shown that FAP-α expression is
`not confined to stromal fibroblasts but that it is also
`expressed in some epithelial malignant cells. Kelly et al.
`[7] analyzed paraffin-embedded breast-cancer sections and
`revealed the expression of FAP-α in cancer cells. A study
`by Okada K et al. [8] showed that FAP-α immunoreactivity
`was recognized in both intestinal-type and diffuse type of
`gastric cancer accompanied with different levels of protein
`expression when detected by immunoblotting. FAP-α
`immunoreactivity was observed in some microinvasive
`
`© 2014 Jia et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative
`Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and
`reproduction in any medium, provided the original work is properly credited.
`
`Petitioner GE Healthcare – Ex. 1026, p. 1
`
`

`

`Jia et al. BMC Cell Biology 2014, 15:16
`http://www.biomedcentral.com/1471-2121/15/16
`
`Page 2 of 14
`
`and all invasive cervical carcinomas with various de-
`grees of FAP-α -positive stromal cells [9]. Recently, it
`has been demonstrated that FAP-α is highly expressed
`on the surface of glioma cells, bone and soft tissue tumour
`cells [10,11].
`There are also contradictive results about the function
`of FAP-α, in that it could act as both a tumour suppres-
`sor and tumour promoter. It has been observed that the
`expression of FAP-α decreased the tumourigenicity of
`mouse melanoma cells in animals and restored contact
`inhibition and growth factor dependence [12]. FAP-α
`has also been shown to suppress growth of NSCLC cells,
`accompanied by the increased expression of cell surface
`DPPIV [13]. Furthermore, increased stromal expression
`of FAP-α is shown to be associated with longer survival
`of breast cancer patients [3]. In contrast, it has also been
`shown that FAP-α can also act as a tumour promoter.
`Anti-sense suppression of FAP-α in human breast cancer
`cell lines MDA-MB-435 and MDA-MB-436, which nor-
`mally express FAP-α rendered these cells sensitive to
`serum starvation, whilst high levels of FAP-α expression
`were less dependent on exogenous serum factors for
`growth and gained independence from normal growth
`regulatory controls [14]. The human breast cancer cell
`line MDA-MB-231 expressing FAP-α grew more rapidly
`and was produced highly vascular tumours in vivo [15].
`Mice inoculated with FAP-transfected HEK293 cells
`were two to four times more likely to develop tumours
`compared with vector-transfected HEK293 controls,
`with a 10- to 40-fold enhancement in tumour growth
`[16]. Antibody abrogation of FAP-α enzymatic activity
`by site-directed mutagenesis of FAP-α was shown to
`result in a significant reduction in FAP-driven tumour
`growth in vivo [17].
`A recent investigation suggested that FAP-α promoted
`tumour growth and invasion of breast cancer cells might
`be through non-enzymatic functions. Huang et al. [18]
`introduced different inhibitors of prolyl peptidases in-
`cluding Val-boroPro (talabostat); Glu-boroPro (PT-630);
`or 1-[[(3-hydroxy-1-adamantyl)amino]acetyl]-2-cyano-(S)-
`pyrrolidine (LAF-237) to investigate the function of FAP-
`α on breast cancer cells in a SCID mice model. Their
`results showed that PT-630 and LAF-237 did not slow the
`growth of tumours produced by any of the three breast
`cancer cell lines expressing FAP-α. Talabostat slightly de-
`creased the growth rates of the FAP-α -expressing tu-
`mours but the growth retardation was likely not related to
`the inhibition of FAP-α or the related post-prolyl peptid-
`ase dipeptidyl peptidase IV. Breast cancer cells expressing
`a catalytically inactive mutant of FAP-α (FAPS624A) also
`produced tumours that grew rapidly [18]. In another
`study, the over-expression of FAP-α in the human hepatic
`stellate cell (HSC) cell line LX-2 increased cell adhesion, mi-
`gration and invasion. However the proteolytic activity
`
`of FAP-α was not necessary for these functions [19].
`These findings imply that in addition to its enzymatic
`functions, FAP-α might have important non-enzymatic
`functions involved in regulating the development and
`spread of cancer cells.
`Therefore, in this study we analyzed the function of
`FAP-α in breast cancer cells with the intention to ex-
`plore the non-enzymatic function of FAP-α. Our hy-
`pothesis is that as a membrane protein, FAP-α might
`participate in the regulation of other membrane mole-
`cules or signaling pathways by which exert its influence
`on tumour cells.
`
`Methods
`Materials and cell lines
`Human breast cancer cells, MCF7 and MDA-MB-231
`were from the ATCC (American Type Cell Collection,
`Manassas, VA, USA). Fresh frozen human breast tissues
`were collected from University Hospital of Wales under
`the approval of the local ethical committee, obtained im-
`mediately after surgery and stored at −80°C until used.
`Antibodies to human FAP-α (sc-100528 and ab5066),
`FAK (sc-1680) and pFAK (sc-11765-R were from Santa-
`Cruz Biotechnologies, Inc. (Santa Cruz, CA, USA or
`Abcam, Cambridge, UK). ROCK inhibitor was from
`Santa-Cruz Biotechnologies, Inc. (Santa Cruz, CA, USA),
`ERK inhibitor, Wortmannin, and Wiskostatin were from
`Calbiochem (Nottingham, UK). Matrigel
`(reconstituted
`basement membrane) was purchased from Collaborative
`Research Products (Bedford, MA, USA). Transwell plates
`equipped with a porous insert (pore size 8 μm) were from
`Becton Dickinson Labware (Oxford, UK). RT-PCR reagents
`and plasmid extraction kits were from Sigma (St. Louis,
`MO, USA).
`
`Construction of expression vector of human FAP-α and
`transfection of breast cancer cells
`Touch-down PCR was used to generate the cDNA of
`FAP-α from human prostate tissues with primers 5’-
`TTAGTCTGACAAAGAGAAACACTG and 5’-ATGAA
`GACTTGGGTAAAAATCG. The cDNA of FAP-α was
`subsequently cloned into a pEF6/V5-His vector (Invitro-
`gen, Paisley, Scotland, UK). The new plasmid, named
`pEF6/V5- FAP was amplified in E. coli and verified by
`PCR reaction by using a pair of different primers 5’-
`AGAGCTTTAGCAATCTGTGC and 5’-TCCCTTGCT
`AATTCAAGTGT.
`Breast cancer cells MCF7 and MDA-MB-231 were cul-
`tured in DMEM media. The cells were transfected with
`plasmid pEF6/V5- FAP-α by electroporation. Following
`selection of transfected cells with blasticidin (used at
`5 μg/ml) and verification by PCR, the stably trans-
`fected cells were established: FAP-α over-expression
`cells MCF7exp and MDA-MB-231 exp, plasmid only
`
`Petitioner GE Healthcare – Ex. 1026, p. 2
`
`

`

`Jia et al. BMC Cell Biology 2014, 15:16
`http://www.biomedcentral.com/1471-2121/15/16
`
`Page 3 of 14
`
`control cells MCR7pef and MDA-MB-231pef and the
`wild type cells MCF7wt and MDA-MB-231wt. The
`transfected cells thus created were always kept in a
`maintenance medium which contained 0.5 μg/ml blas-
`ticidin. Pooled populations of genetically manipulated
`cells from multiple clones were used in the subsequent
`studies.
`
`resistance. 96W1E arrays were incubated with complete
`medium for 1 hour. 50,000 cells of breast cancer cells were
`seeded into each well. The electric changes were continu-
`ously monitored for up to 24 hr while an electric wounding
`was performed after 6 hours. Multiple conditions of fre-
`quency 1000 Hz, 2000Hz, 4,000 Hz, and 8,000 Hz were
`used to screen the nature of resistance changes.
`
`In vitro cell function including cell growth, adhesion,
`invasion, and migration assay
`Cell growth assay: cells were plated into 96-well plated
`at 2,000 cells/well. Cells were fixed in 10% formaldehyde
`on the day of plating, and the day3 and day 5 subse-
`quently. 0.5% crystal violet (w/v) was used to stain cells.
`Following washing, the stained crystal violet was dis-
`solved with 10% (v/v) acetic acid and the absorbance
`was determined at a wavelength of 540 nm using an
`ELx800 spectrophotometer (Bio-Tek, ELx800). Absorb-
`ance represents the cell number.
`Adhesion assay: a 96-well plate was pre-coated with
`5 μg of Matrigel and allowed to dry overnight. Following
`rehydration with serum-free media, 20,000 cells were
`seeded into each well. After 40 min of incubation, non-
`adherent cells were washed off using BSS buffer. The
`remaining cells were fixed with 4% formalin and stained
`with 0.5% crystal violet. The number of adherent cells
`was then counted under microscopy.
`Invasion assay: transwell inserts (upper chamber) with
`8 μm pore size were coated with 50 μg of Matrigel (Col-
`laborative Research Products, Bedford, Massachusetts,
`USA) and air-dried. Following rehydration with serum-
`free media, cells were seeded at a density of 30,000 per
`insert. After 3 day’s incubation, cells that had migrated
`through the matrix and adhered to the other side of
`the insert were fixed in 4% formalin, stained with 0.5%
`(weight/volume) crystal violet, and counted under a
`microscope.
`Migration/wounding assay: cells were seeded at a
`density of 250,000 per well into a 24-well plate and
`allowed to reach confluence by overnight culture. The
`monolayer of cells was then scraped with a fine gauge
`needle to create a wound of approximately 200 μm.
`The movement of cells to close the wound was recorded
`for 4 hours. The movement of cells were analyzed by track-
`ing cell boundary, for each frame in a series, using the
`Optimas 6.0 motion analysis (Meyer Instruments, Houston,
`Texas).
`
`Electric Cell-substrate Impedance Sensing (ECIS) based
`cell adhesion and motility assay
`Electric Cell-substrate Impedance Sensing (ECIS, Applied
`instrument ECIS Zθ
`Biophysics Inc, Troy, NY, USA)
`(Theta) was also used to record both cell adhesion and mi-
`gration abilities which were shown here as the changes of
`
`Influence of inhibitors of signalling pathway on adhesion
`and migration of breast cancer cells by ECIS assay
`In order to explore the potential crosstalk of FAP-α and
`other adhesion and migration associated signalling path-
`way. We introduced inhibitors of FAK, ROCK, PLC-γ,
`and PI3K pathway in ECIS based cell adhesion and mo-
`tility assay. 50,000 cells of breast cancer cells were sus-
`pended in 200 ul media with inhibitors of FAK, ROCK,
`PLC-γ, and PI3K respectively and the final concentration
`was 100 nm. The electric changes were continuously
`monitored for up to 24 hr under multiple condition of
`frequency while an electric wounding was performed
`after 6 hours.
`
`Flow cytometric analysis of in breast cancer cells
`In this study, we utilised the Vybrant® Apoptosis Assay Kit
`(Invitrogen, Inc., Paisley, UK) to perform the apoptosis
`assay. Cells including those suspended in the culture
`medium were harvested and washed in cold BSS buffer.
`After centrifugation, the cell pellet was resuspended in 1X
`annexin-binding buffer. Determine the cell density and di-
`lute in 1X annexin-binding buffer to about 1 × 106 cells/ml.
`5 μl of FITC annexin V and 1 μl of the PI working solution
`(100 μg/ml) were added to each 100 μl of cell suspension
`and incubated at room temperature for 5 min. After the in-
`cubation, 400 μl of 1X annexin-binding buffer was
`added, mixed gently and stored on ice. Cells were ana-
`lyzed using the Partec CyFlow® SL flow cytometer and
`FlowMax software package (Partec GmbH, Munster,
`Germany), measuring the fluorescence emission at 530 nm
`and >575 nm.
`
`Immunofluorescence staining in breast cancer cells
`20,000 cells were seeded in each well of a 16-well chamber
`and cultured overnight. Then cells were fixed in 100%
`ethanol for 30 minutes. After blocked in a 10% horse
`serum solution, cells were incubated with primary anti-
`bodies overnight and were incubated for 30 min in the
`secondary FITC- and TRITC conjugated antibodies. Fol-
`lowing extensive washings, the slides were mounted using
`Fluorsave™ mounting media (Calbiochem, Nottingham,
`UK) and allowed to harden overnight in the refrigerator
`before being examined. Slides were examined using an
`Olympus fluorescence microscope and photographed
`using a Hamamatsu digital camera. The images were
`
`Petitioner GE Healthcare – Ex. 1026, p. 3
`
`

`

`Jia et al. BMC Cell Biology 2014, 15:16
`http://www.biomedcentral.com/1471-2121/15/16
`
`Page 4 of 14
`
`documented using the Cellysis software (Olympus, Bristol,
`England, UK).
`
`Western blotting and Immunoprecipitation
`To detect the expression level of FAP-α in breast cancer
`cell lines, confluent cells were pelleted and then lysed
`using a lysis buffer containing 2.4 mg/ml Tris, 4.4 mg/
`ml NaCl, 5 mg/ml sodium deoxycholate, 20 μg/ml
`sodium azide, 1.5% Triton, 100 μg/ml PMSF, 1 μg/ml
`leupeptin, and 1 μg/ml aprotinin, for 45 min at 4°C.
`After lysis and centrifugation at 13,000 rpm for 15 min,
`protein concentrations for each sample were measured
`using an improved Lowary assay (DC Protein Assay kit,
`Bio-Rad). The samples were adjusted to equal concen-
`trations with sample buffer and then boiled at 100°C
`for 5 min, before separated on a 10% polyacrylamide
`gel. Following electrophoresis, these separated proteins
`were transferred onto nitrocellulose sheets and blocked
`in 10% skimmed milk (w/v in TBS) for overnight. The
`membranes were then probed with the anti-FAP-α, anti-
`FAK antibodies, and anti-GAPDH antibody as internal
`control, followed by a peroxidase-conjugated secondary
`antibody. Protein bands were visualised using an ECL
`system (Amersham, UK), and photographed using an
`UVITech imager (UVITech, Inc). The proteins obtained
`from breast cancer cells were immunoprecipitated with
`10 μl of anti-FAP-α and anti-FAK antibodies for 2 h at
`4°C followed by the addition of 20 μl of protein A/G-
`agarose beads overnight at 4°C. The resultant pellet was
`subjected to SDS-PAGE and Western blotting by anti-
`bodies against the FAP-α and phosphatised FAK.
`
`Human breast tissues
`A total of 133 breast samples were obtained from breast
`cancer patients (106 breast cancer tissues and 27 associ-
`ated background or related normal tissue). The anon-
`ymised breast tissue samples were obtained within the
`guidelines of the appropriate ethics committee (Bro Taf
`Health Authority 01/4303 and 01/4046). Informed patient
`consent was not applicable in this instance (as stated in the
`Human Tissue Act 2004, UK). The pathologist verified
`normal background and cancer specimens, and it was con-
`firmed that the background samples were free from tumour
`deposit. These tissues after mastectomy were immediately
`frozen in liquid nitrogen.
`
`Real-time quantitative Polymerase Chain Reaction (Q-PCR)
`The assay was based on the Amplifluor system. It was
`used to detect and quantify transcript copy number of
`FAP-α in tumour and background samples. Primers were
`designed by Beacon Designer software, which included
`complementary sequence to universal Z probe (Intergen,
`Inc.). Each reaction contains 1 pmol reverse primer
`(which has the Z sequence), 10 pmol of FAM-tagged
`
`universal Z probe (Intergen, Inc.) and cDNA (equivalent
`to 50 ng RNA). Sample cDNA was amplified and quantified
`over a large number of shorter cycles using an iCyclerIQ
`thermal cycler and detection software (BioRad laboratories,
`Hammelhempstead, UK) under the following conditions:
`an initial 5 minute 94°C period followed by 60 cycles of
`94°C for 10 seconds, 55°C for 15 seconds and 72°C for
`20 seconds. Detection of GAPDH copy number within
`these samples was later used to allow further standard-
`isation and normalisation of the samples.
`
`Statistical Analysis
`All of the results are expressed as the means ± S.E. Cell
`growth, wounding or migration, adhesion, and invasion
`formation was analyzed using a Student's t test on log
`normalized data or Mann Witney for patient tissues
`(where required).
`
`Results
`Expression of FAP-α in breast tumour is correlated with
`patient prognosis and survival
`Analysis carried out using Q-PCR (using CK-19 to nor-
`malise) revealed that patients with poor outcome had
`the highest levels of FAP-α (Figure 1A). Patients who
`remained alive and well had significantly lower levels of
`FAP-α than those who had died from breast cancer or
`those who had poor outcomes in general (normalised
`transcript copy number/50 ng RNA was alive and well
`0.878 ± 0.533; median value <0.001: died from breast
`cancer 6.44 ± 5.27; median value 0.1: all poor outcomes
`(recurrence, metastasis, death) 4.11 ± 3.31; median value
`0.02, p = 0.0059 and p = 0.0247 respectively). Lower
`levels were also evident in those patients who had bone
`metastasis (9.1 ± 8.8; median value 0.02, p = 0.052). FAP-
`α was also significantly increased in ER positive and ERβ
`positive tumours (Figure 1B). When long-term survival
`was analysed using Kaplan-Meier survival curves, pa-
`tients with high levels of FAP-α transcript had a signifi-
`cantly shorter survival than patients with low levels of
`FAP-α (p = 0.036); High levels of FAP-α, mean survival
`98.222 ± 17 months (64.853-131.591 months, 95% CI)
`low levels of FAP-α, 137.587 ± 4.84 months
`versus
`(128.587-147.086 months, 95% CI, cut-offs as previously
`determined [20]). This was also seen in patients who had
`remained disease free, who had lower levels of FAP-α
`(p = 0.024); High levels of FAP-α, mean survival 90.73 ±
`16.8717 months (58.447-121.983 months, 95% CI) versus
`low levels of FAP-α, 132.313 ± 5.27 months (121.963-
`142.642 months, 95% CI). Immunohistochemical staining
`showed a corresponding increase in protein levels of FAP-α
`in tumour tissues when compared to background tissue
`(Figure 1E). The data for the patient cohort is summarised
`in Table 1.
`
`Petitioner GE Healthcare – Ex. 1026, p. 4
`
`

`

`Jia et al. BMC Cell Biology 2014, 15:16
`http://www.biomedcentral.com/1471-2121/15/16
`
`Page 5 of 14
`
`Figure 1 (See legend on next page.)
`
`Petitioner GE Healthcare – Ex. 1026, p. 5
`
`

`

`Jia et al. BMC Cell Biology 2014, 15:16
`http://www.biomedcentral.com/1471-2121/15/16
`
`Page 6 of 14
`
`(See figure on previous page.)
`Figure 1 Analysis of human breast cancer and background tissues. (A) Q-PCR revealed a significant increase in FAP-α expression with poor patient
`outcome. (B) Expression was also increased in ER positive and ERβ positive patients. (C) Kaplan-Meier survival curves showing overall survival analysis of
`patients expressing FAP-α. (D) Kaplan-Meier survival curves showing disease-free survival analysis of patients with breast cancer. (E) Immunohistochemical
`staining of FAP-α in background breast tissues (left) and tumour/associated tissues (right).
`
`Expression of FAP-α in breast cancer cell lines
`We analysed the expression pattern of FAP-α in MCF7
`and MDA-MB-231 breast cancer cell lines. When using
`RT-PCR, we found no transcript of FAP-α mRNA in the
`breast cancer cell lines (Figure 2A). After transfection
`with plasmid pEF6/V5-FAP-α, transcription of FAP-α
`mRNA could be amplified and an increased expression
`of FAP-α was also detected in MCF7exp and MDA-MB-
`231exp cells (Figure 1B). GAPDH was used as a standard
`control. Western blotting for the FAP-α protein showed
`successful protein expression in both MCF7 and MDA-
`MB-231 cells (Figure 1C).
`
`Over-expression of FAP-α promotes growth of MCF-7 cells
`and has no effect on apoptosis
`In the in vitro cell growth assay, it was observed that a
`significantly higher rate of growth was achieved in
`FAP-α transfected MCF7 cells (Figure 3A), but that
`there was little change in MDA-MB-231 breast cancer
`cell growth (Figure 3B). In order to ascertain whether
`apoptosis in the cells was reduced, we used flow cy-
`tometry to analyse the relative expression of Annexin
`V. The results showed that the rate of apoptosis in
`MCF7wt, MCF7pef, and MCF7exp were 9.03%, 6.61%,
`4.63% respectively in serum free medium and those in
`cells cultured in normal media were 5.73%, 6.53%, and
`7.21%. There was no significant difference between
`cells (Figure 3C).
`
`Over-expression of FAP-α impairs human breast cancer
`cell migration
`Using a matrigel based in vitro invasion assay, it was
`found that MCF7exp and MDA-MB-231exp cells had in-
`creased invasion ability compared with those of the wild
`type and control cells although this did not reach signifi-
`cance (MCF7wt, MCF7pef, MCF7exp, MDA-MB-231wt,
`MDA-MB-231pef, and MDA-MB-231exp cells were
`17.8 ± 17.3, 17.4 ± 15.7, 55.3 ± 34.8, 65.2 ± 36.9, 99.0 ±
`72.2, and 112.6 ± 36.8 respectively, P > 0.05) (Figure 4A).
`When we examined any effect on cell adhesion to base-
`ment membrane, it was seen that MCF7exp cells exhib-
`ited lower adhesion but
`that MDA-MB-231exp cells
`were more adhesive compared with those of the wild
`type and control cells, although this did not achieve
`significance (MCF7wt, MCF7pef, MCF7exp, MDA-MB-
`231wt, MDA-MB-231pef, and MDA-MB-231exp cells were
`31.3 ± 20.6, 24.3 ± 12.4, 26.7 ± 31.5, 12.7 ± 18.8, 15.5 ± 15.6,
`and 14.0 ± 14.4 respectively, P > 0.05) (Figure 4B). This
`may be due to the different aggressive behaviour of the
`cell lines, as MDA-MB-231 cells are intrinsically more
`invasive.
`To investigate the impact of FAP-α on migration of cells,
`we used the ECIS based wounding assay. This enabled a de-
`tailed analysis of the attachment and migration of the cells
`in two spate phases. ECIS enables us to firstly measure the
`rate of attachment of the cells to the substratum; the faster
`the resistance increases, the greater the rate of attachment,
`and secondly by enabling us to measure migration of cells
`
`Table 1 Patient population data of samples included in the analyses
`Tissue Type
`Background (32)
`
`Tumour (120)
`
`Tumour Grade
`
`NPI
`
`TNM
`
`Histology
`
`Outcome
`
`Grade 1 (22)
`
`Grade 2 (40)
`
`Grade 3 (15)
`
`Unknown (43)
`
`NPI 1 (43)
`
`NPI 2 (37)
`
`NPI 3(15)
`
`Unknown (5)
`
`TNM 1 (22)
`
`TNM 2 (37)
`
`TNM 3 (7)
`
`TNM 4 (4)
`
`Unknown (48)
`
`Ductal (94)
`
`Lobular (13)
`
`Other (13)
`
`Disease free (86) Metastatic disease (6)
`
`Local recurrence (5) Death from breast
`cancer (16)
`
`All poor outcomes (27)
`
`Petitioner GE Healthcare – Ex. 1026, p. 6
`
`

`

`Jia et al. BMC Cell Biology 2014, 15:16
`http://www.biomedcentral.com/1471-2121/15/16
`
`Page 7 of 14
`
`Figure 2 Expression of FAP-α in human breast cancer cell lines. (A) RT-PCR showing the lack of expression of FAP-α in MCF7 and MDA-MB-231
`human breast cancer cell lines. (B) Cells transfected with a FAP-α expression plasmid. GAPDH was used as a control. (C) Western blotting showing
`successful expression of FAP-α in both cell lines.
`
`into a wound created in the confluent cell monolayer after
`the addition of a high voltage shock. The reduced resistance
`associated with the “wound” is then reversed as cells move
`into the cleared area, the resistance plateauing when the
`cleared space is filled. In the adhesion phase of ECIS,
`MCF7exp cell showed reduced attachment after 2 hours,
`whereas MDA-MB-231exp attachment was
`increased,
`compared to control cells (Figure 4B) (p < 0.05, n = 8). The
`confluent cell monolayer was then wounded and the ex-
`periment resumed to examine changes in migration. In the
`migration phase, the results showed that the motility of
`both MCF7exp cells and MDA-MB-231exp cells was dra-
`matically reduced compared to the wild type and control
`cells (P < 0.05) (Figure 4D).
`
`FAK inhibitor could restore the impaired motility ability
`of breast cancer cells.
`In searching for the potential pathway(s) that may be re-
`sponsible for the impact of FAP-α expression on breast
`cancer cells, we screened a panel of small molecule in-
`hibitors to some of the key signalling pathways that are
`linked to cell motility. They included the ROCK inhibi-
`tor, JNK inhibitor, PI3K inhibitor, FAK inhibitor and
`ERK inhibitor. Using ECIS (n = 16 for each experiment),
`we assessed the effect of these inhibitors on cell migra-
`tion/motility. Again, we looked at the two phases of the
`experiment, attachment and migration. There was little
`difference in attachment upon addition of the small in-
`hibitors to MCF7exp cells (not shown) but a small dif-
`ference with the FAK inhibitor (Figure 5A and B). Only
`the FAK inhibitor was seen to partially restore the in-
`hibitory effect of FAP-α on the motility of MCF7exp
`cells (Figure 5C and D). Again, there was little difference
`in after the addition of the inhibitors on MDA-MB-
`231exp attachment (Figure 6A and B). The FAK inhibi-
`tor was able to partially restore the inhibitory effect of
`FAP-α expression in MDA-MB-231 cells (Figure 6C
`
`and D), as in the MCF7 cells. ERK inhibitor had only a
`marginal effect on the motility of the control breast
`cancer cells however it reversed the inhibition of motility
`in MDA-MB-231exp cells to that of the control. This was
`more evident at the early phase (within 2 hours after
`wounding) (Figure 6D).
`
`Over-expression of FAP-α accompanied with a reduction
`of phosphorylated FAK
`To investigate the potential crosstalk of FAP-α and the
`FAK pathway, we analyzed the proteins expression of
`FAP-α and the phosphorylation status of FAK. As shown
`in Figure 7A, over-expression of FAP-α in MCF7exp
`cells and MDA-MB-231exp cells accompanied a de-
`crease in phosphorylated FAK (pFAK) when cultured in
`both normal media and serum-free media. Addition of
`the FAK inhibitor (FAKi) could restore the levels of FAK
`phosphorylation in both MCF7exp cells and MDA-MB-
`231exp cells (Figure 7A). Furthermore, we analyzed the
`expression of FAK in all genetically modified cells. The
`results showed that the over-expression of FAP-α in
`MCF7exp and MDA-MB-231exp cells had no influence
`on the transcription of FAK compared with those of wild
`type and control cells (Figure 7B).
`Immunofluorescent staining of FAP-α and FAK in
`both MCF7 and MDA-MB-231 cells showed that the
`over-expression of FAP-α accompanied a reduction
`in the fluorescence intensity of phosphorylated FAK
`(Figure 7C, second row). In addition, the inhibitor of
`FAK could partially restore the expression of phos-
`phorylated FAK (Figure 7C, bottom row). The human
`breast cancer cell line BT549 was used as a positive
`control for endogenous FAP-α expression.
`
`Discussion
`Fibroblast Activation Protein alpha (FAP-α) is an inte-
`gral membrane serine peptidase. It has been shown that
`
`Petitioner GE Healthcare – Ex. 1026, p. 7
`
`

`

`Jia et al. BMC Cell Biology 2014, 15:16
`http://www.biomedcentral.com/1471-2121/15/16
`
`Page 8 of 14
`
`Figure 3 Growth of human breast cancer cells overexpressing FAP-α. (A) There was an increase in growth of MCF7exp cells compared to
`the controls (n = 8). (B) No equivalent increase was observed in MDA-MB-231 cells. (C) Apoptosis was not reduced in MCF7exp cells.
`
`it plays an important role in tumour proliferation, mi-
`gration, invasion and angiogenesis. Recent studies have
`provided convincing evidence that targeting FAP-α is a
`promising method in both diagnosis and treatment of can-
`cer. A combination of FAP-α with other serum markers
`such as CEA, CYFRA 21–1, OPN, ferritin, and anti-p53
`
`immunochemical
`had comparable sensitivity with faecal
`testing (FIT) for the early detection of colorectal cancer
`[21]. Immunotherapy targeting FAP-α could inhibit tumour
`growth and increases survival in a murine colon cancer
`model. A DNA vaccine directed against FAP-α could
`significantly suppressed primary tumour and pulmonary
`
`Petitioner GE Healthcare – Ex. 1026, p. 8
`
`

`

`Jia et al. BMC Cell Biology 2014, 15:16
`http://www.biomedcentral.com/1471-2121/15/16
`
`Page 9 of 14
`
`Figure 4 (See legend on next page.)
`
`Petitioner GE Healthcare – Ex. 1026, p. 9
`
`

`

`Jia et al. BMC Cell Biology 2014, 15:16
`http://www.biomedcentral.com/1471-2121/15/16
`
`Page 10 of 14
`
`(See figure on previous page.)
`Figure 4 Effect on FAP-α overexpression and cellular behaviour. (A) Increased invasion was observed in both MCF7 and MDA-MB-231 cells
`Overexpressing FAP-α (n = 8). (B) Adhesion to basement membrane showed that MCF7exp cells exhibited lower adhesion but that MDA-MB-231exp cells
`were more adhesive (n = 8). (C, top) ECIS experiments showed that MCF7exp cell showed reduced attachment after 2 hour, whereas MDA-MB-231exp
`attachment was increased (C, bottom). (D) In the migration phase, motility of both MCF7exp cells and MDA-MB-231exp cells was dramatically reduced
`compared to the wild type and control cells (n = 16).
`
`Figure 5 Effect of small inhibitors on the impaired motility ability of MCF7 breast cancer cells. A panel of small inhibitors linked to
`motility was screened, with only the FAK inhibitor having a substantial effect. ECIS was used to assess the effect of these inhibitors on cell
`migration/motility. Again, we looked at the two phases of the experiment, attachment and migration. (A and B) There was little difference in
`attachment upon addition of the small inhibitors to MCF7exp cells (n-16). (C and D) The FAK inhibitor was seen to partially restore the inhibitory
`effect of FAP-α on the motility of MCF7exp cells (n = 16).
`
`Petitioner GE Healthcare – Ex. 1026, p. 10
`
`

`

`Jia et al. BMC Cell Biology 2014, 15:16
`http://www.biomedcentral.com/1471-2121/15/16
`
`Page 11 of 14
`
`Figure 6 Effect of small inhibitors on the impaired motility ability of MDA-MB-231 breast cancer cells. (A and B) As for MCF-7 cells,
`there was little difference in after the addition of the inhibitors on MDA-MB-231exp attachment (n = 16). (C and D) The FAK inhibitor was
`able to partially restore the inhibitory effect of FAP-α expression in MDA-MB-231 cells (n = 16) (D).
`
`metastases through CD8+ T-cell-mediated killing in
`tumour-bearing mice [22]. An antibody-maytansinoid
`conjugate, monoclonal antibody (mAb) FAP5-DM1 targeted
`at a shared epitope of human, mouse, and cynomolgus
`monkey FAP,
`could induced long-lasting
`inhibition
`of tumour growth and complete regressions in xenograft
`models of lung, pancreas, and head and neck cancers with no
`signs of intolerability [23]. The clinical impact of FAP-α was
`also tested using Val-boroPro (Talabostat), the first clinical in-
`hibit