2705–2716
`Nucleic Acids Research, 2003, Vol. 31, No. 11
`DOI: 10.1093/nar/gkg393
`
`Structural variations and stabilising modifications of
`synthetic siRNAs in mammalian cells
`
`Frank Czauderna, Melanie Fechtner, Sibylle Dames, Hu¨ seyin Aygu¨ n1, Anke Klippel,
`Gijsbertus J. Pronk, Klaus Giese and Jo¨ rg Kaufmann*
`
`Atugen AG, Otto Warburg Haus (No. 80), Robert-Roessle-Strasse 10, 13125 Berlin, Germany and 1BioSpring,
`Hanauer Landstrasse 526, 60386 Frankfurt, Germany
`
`Received March 20, 2003; Revised and Accepted April 11, 2003
`
`ABSTRACT
`
`interfering RNAs (siRNA)
`Double-stranded short
`induce post-transcriptional silencing in a variety of
`biological systems. In the present study we have
`investigated the structural requirements of chemic-
`ally synthesised siRNAs to mediate efficient gene
`silencing in mammalian cells. In contrast to studies
`with Drosophila extracts, we found that synthetic,
`double-stranded siRNAs without specific nucleotide
`overhangs are highly efficient in gene silencing.
`Blocking of the 5¢-hydroxyl terminus of the anti-
`sense strand leads to a dramatic loss of RNA inter-
`ference activity, whereas blocking of the 3¢ terminus
`or blocking of the termini of the sense strand had
`no negative effect. We further demonstrate that syn-
`thetic siRNA molecules with internal 2¢-O-methyl
`modification, but not molecules with terminal modi-
`fications, are protected against serum-derived
`nucleases. Finally, we analysed different sets of
`siRNA molecules with various 2¢-O-methyl modifica-
`tions for stability and activity. We demonstrate that
`2¢-O-methyl modifications at specific positions in
`the molecule improve stability of siRNAs in serum
`and are tolerated without significant loss of RNA
`interference activity. These second generation
`siRNAs will be better suited for potential therapeutic
`application of synthetic siRNAs in vivo.
`
`INTRODUCTION
`
`The term RNA-mediated interference (RNAi) was initially
`introduced by Fire and co-workers (1)
`to describe the
`observation that injection of double-stranded RNA (dsRNA)
`into the nematode Caenorhabditis elegans can block expres-
`sion of genes highly homologous in sequence to the delivered
`dsRNA. RNAi is evolutionarily conserved among eukaryotes
`and it appears to have an essential role in protecting the
`genome against invasion by pathogens such as viruses, which
`generate dsRNA molecules upon activation and replication
`(2). Most recently two independent studies demonstrated that
`the yeast RNAi machinery is required for the formation and
`
`maintenance of heterochromatin during mitosis and meiosis,
`indicating additional functions for RNAi (3,4). In the past,
`repression of genes by long dsRNAs has been less successful
`in mammalian cells with the exception of embryonic cells
`(5,6). Use of short (<30 nt) synthetic dsRNAs allowed for
`sequence-specific gene silencing yet avoided the non-selective
`toxic effects of long dsRNAs in differentiated mammalian
`cells (7). This discovery triggered a much wider interest in the
`RNAi phenomenon since it provides a new avenue for loss of
`function studies in somatic cells of vertebrates. Initial studies
`with these small interfering RNAs (siRNAs) demonstrated
`that the duplex must have 2 or 3 nt overhanging 3¢ ends for
`efficient cleavage destruction of the target mRNA (8). The 3¢
`overhangs can be generated by cleavage of long dsRNA into
`siRNAs by a multidomain RNase III-like enzyme, known as
`Dicer (9). In a subsequent step the siRNA associates with the
`RNAi-induced silencing complex (RISC), which is then
`guided to catalyse the sequence-specific degradation of the
`mRNA (9–11).
`RNAi induced by synthetic siRNAs is transient, and in
`mammalian cell culture systems re-expression of the target
`mRNA usually occurs after a few days (12,13). Therefore an
`improvement in the intracellular and extracellular stability of
`the effector molecules will be one crucial aspect for the
`successful in vivo application of synthetic siRNAs. A variety
`of chemical modifications, including terminal and internal
`modifications (e.g. 2¢-O-modification or phosphorothioate
`linkages), have been tested to see whether they influence
`RNAi inducing activity (7,8,13–15). However, these studies
`did not adequately assess the effect of the different modifi-
`cations on sensitivity of these molecules to siRNA-degrading
`serum-derived nucleases.
`In the present work we define the minimal structural
`requirements of siRNAs in mammalian cells and test a series
`of chemical modifications to improve the stability of siRNAs
`for future in vivo applications. To determine differences in
`potency, we measured the inhibition of expression of several
`targets, including PTEN, p110b and Akt1, which are all
`members of the phosphatidylinositol (PI) 3-kinase pathway
`(16,17). Surprisingly, we found no overhang dependence of
`the siRNA duplexes in HeLa cells, which is in contrast to
`observations made in the Drosophila system (15). We have
`established the minimal required size for functional siRNAs in
`HeLa cells and have developed functionally active siRNA
`
`*To whom correspondence should be addressed. Tel: +49 30 9489 2833; Fax: +49 30 9489 2801; Email: kaufmann@atugen.com
`
`Nucleic Acids Research, Vol. 31 No. 11 ª Oxford University Press 2003; all rights reserved
`
`Alnylam Exh. 1028
`
`

`

`2706 Nucleic Acids Research, 2003, Vol. 31, No. 11
`
`molecules with increased nuclease resistance. Our results
`provide a basis for the further development of synthetic siRNA
`molecules with improved characteristics, including higher
`resistance to serum-derived endonucleases.
`
`MATERIALS AND METHODS
`
`Synthetic siRNAs and GeneBlocs
`
`Synthetic siRNAs were purchased from BioSpring (Frankfurt,
`Germany). The oligoribonucleotides were resuspended in
`RNase-free TE to a final concentration of 50 mM. In the case of
`bimolecular siRNA molecules, equal aliquots (100 mM) were
`combined to a final concentration of 50 mM. For the formation
`of duplexes the siRNAs were incubated at 50(cid:176)C for 2 min in
`annealing buffer (25 mM NaCl, 5 mM MgCl2) and were
`cooled down to room temperature. The PTEN-specific
`GeneBlocs
`used
`have
`the
`schematic
`structure
`cap-
`nnnnnnNNNNNNNNnnnnnn-cap, as published previously
`(16), where cap represents an inverted deoxy abasic modifi-
`cation, n stands for 2¢-O-methyl ribonucleotides (A, G, U or C)
`and N represents phosphorothioate-linked deoxyribonucleo-
`tides (A, G, T or C).
`
`Cell culture and transfections
`
`line used in the experiments
`The particular HeLa cell
`presented was a gift
`from M. Gossen (MDC, Berlin,
`Germany) and was grown in Eagle’s minimum essential
`medium with 2 mM L-glutamine, Earle’s balanced salt
`solution, 1 mM sodium pyruvate, 0.1 mM non-essential
`amino acids and 10% fetal bovine serum (FBS). Synthetic
`siRNA and antisense GeneBloc transfections were carried out
`in 96-well or 10 cm plates (at 30–50% confluency) by using
`cationic lipids such as Oligofectamine (Invitrogen, Carlsbad,
`CA) or NC388 (Atugen, Berlin, Germany) as reported
`previously (16). HeLa cells were transfected by adding a
`pre-formed 53 concentrated complex of siRNAs and lipid in
`serum-free medium to cells in complete medium. The total
`transfection volume was 100 ml for cells plated in 96-wells and
`10 ml for cells in 10 cm plates. The final lipid concentration
`was 0.8–1.2 mg/ml depending on cell density; the siRNA
`concentration is indicated in each experiment.
`
`Antibodies and immunoblotting
`
`Cell lysates were prepared and aliquots of the cell extracts
`containing equal amounts of protein were analysed by
`immunoblotting as described previously (16,17). The murine
`monoclonal anti-p110a antibody has been described (18).
`Rabbit polyclonal anti-Akt and anti-phospho-Akt
`(S473)
`antibodies were obtained from Cell Signalling Technology.
`The murine monoclonal anti-PTEN antibody was from Santa
`Cruz Biotechnology.
`
`Quantitation of mRNA by Taqman analysis
`
`The RNA of cells transfected in 96-wells was isolated and
`purified using the Invisorb RNA HTS 96 kit (InVitek GmbH,
`Berlin, Germany). Inhibition of targeted mRNA expression
`was detected by real time RT–PCR (Taqman) analysis using
`300 nM 5¢ forward primer, 300 nM 3¢ reverse primer and
`100 nM Fam-Tamra-labelled Taqman probe. The gene-
`specific primer sequences can be obtained on request. The
`
`reaction was carried out in 50 ml and assayed in an ABI
`PRISM 7700 Sequence detector (Applied Biosystems) accord-
`ing to the manufacturer’s instructions under the following
`conditions: 48(cid:176)C for 30 min, 95(cid:176)C for 10 min, followed by
`40 cycles of 15 s at 95(cid:176)C and 1 min at 60(cid:176)C.
`
`Nuclease resistance assay
`For the stability assay 5 ml of (2.5 mM) siRNA was incubated
`in 50 ml of fetal bovine serum for 15 or 120 min at 37(cid:176)C. The
`solution was extracted with phenol and siRNA was precipi-
`tated with ethanol and separated on 10% polyacrylamide gels
`followed by ethidium bromide staining. Equal amounts of
`siRNA before serum incubation (0 min) was extracted with
`phenol in parallel and loaded as an input control.
`
`RESULTS
`
`Comparison of synthetic siRNAs and antisense molecules
`in HeLa cells
`
`As most published studies with siRNA in mammalian cells
`have involved the knock-down of ectopically or abundantly
`expressed genes, we first set out to demonstrate that synthetic
`siRNAs can be efficient tools in reducing endogenous mRNA
`and protein levels. For this purpose we designed and analysed
`siRNA molecules specific for the tumour suppressor PTEN.
`For comparison and as a positive knock-down control, we
`employed in parallel conventional antisense molecules
`containing the same nucleotide sequences. The antisense
`molecules, here called GeneBlocs, consisted of nine internal
`deoxyribonucleotides for activation of RNase H flanked by six
`2¢-O-methyl-modified ribonucleotides, whereas the siRNAs
`used consisted of
`two 21mer
`ribonucleotides with two
`deoxythymidine nucleotides at the 3¢ termini (Fig. 1A). The
`double-stranded siRNA as well as
`the single-stranded
`GeneBlocs are identical in length (21mer + terminal modifi-
`cations). To control for non-specific transfection effects, we
`included mismatch sequences as negative controls. HeLa cells
`were transfected with increasing amounts of these molecules
`and the PTEN mRNA level was analysed 24 h later by real
`time PCR (Taqman). The maximal reduction of PTEN mRNA
`normalised to the mRNA of p110a, one of the catalytic
`subunits of PI 3-kinase, was reached with 2.2 nM siRNA and
`20 nM GeneBloc (Fig. 1B). To verify the result on the mRNA
`level, we analysed protein reduction induced by antisense
`GeneBloc and siRNA transfection in a second set of experi-
`ments. HeLa cells were transfected with increasing amounts of
`these molecules and cell lysates were analysed 48 h later by
`immunoblot analysis using PTEN-specific antibodies. p110a
`protein level served as a loading control (Fig. 1C). Maximal
`PTEN protein knock-down was detected with 2.5 nM
`siRNA and 15 nM GeneBloc. These experiments demonstrate
`that siRNA molecules can efficiently reduce mRNA and
`protein levels of endogenous genes. Furthermore,
`these
`siRNAs
`can be more
`efficient
`in mediating mRNA
`reduction when compared to conventional antisense molecules
`directed against
`the same target sequence. The observed
`differences in efficacy may be due to different mechanisms
`of target recognition and/or degradation and may reflect
`the involvement of more efficient catalytic steps in the case
`of RNAi.
`
`

`

`fTBNlA
`PTBNlB
`
`PTBNl»t-!
`PTBNl.a-M
`
`S'
`cquua9cagaaacaaaa9ga9-TT
`3 ' TT-goaaucc;rueuuuguuuucouo
`•
`•
`•
`•
`S '
`oqu.9a;oaoaaa9aaaau9a9-TT
`3 ' TT-gcacuoquguuucuuuuacuc
`
`A
`
`C
`
`PRN GB
`
`PTBN GBl'9-i
`
`S'
`
`S'
`
`iB-ouoouuTTGTTTCTGouaaog- iB
`•
`
`iB-cucauuTTCTTTGTGoucaeq-iB
`
`•
`
`• •
`
`Nucleic Acids Research, 2003, Vol. 31, No. 11
`
`2707
`
`B
`
`~
`
`!:!
`0
`~ 1.2
`<I.
`1
`z 0.8
`w
`~ 0,6
`a.
`.. 0,2
`0 ., 0,4
`a:
`
`0
`
`~
`- 1
`~ 1,2
`~
`<I.
`z 0,8
`w
`~
`0,6
`Q.
`., .. 0,2
`0
`0,4
`a:
`
`0
`
`35nM
`8.75nM
`Q 2,2nM
`a 0,55nM
`(cid:127) 0,13nM
`(cid:127) 003nM
`
`O 40nM
`(cid:143) 20nM
`1onM
`llil 5nM
`
`slRNA
`
`UT
`
`PTEN
`1AB
`
`PTEN
`1ABMM
`
`GeneBloc
`
`UT
`
`PTEN
`GB
`
`PTEN
`GBMM
`
`GeneBloc
`
`siRNA
`
`UT 0,9 3.7 15 60 0.15 0.6 2.5 10 nM
`
`- -----------
`
`p110c,
`
`PTEN - __ _
`
`1 2
`
`3 4
`
`5 6 7 8 9
`
`Figure 1. mRNA and protein knock-down of endogenous PTEN and induced by transfection of siRNA or GeneBloc (GB, antisense) in HeLa cells. (A) The
`sense (A) and antisense (B) strands of siRNA targeting human PTEN mRNA are shown in comparison to the corresponding GeneBloc (antisense molecules).
`siRNAs were synthesised with 2 nt deoxythymidine (TT) 3¢ overhangs. GeneBlocs representing the third generation of antisense oligonucleotides with
`inverted abasic (iB) end modifications (see Materials and Methods). The sequences of the respective mismatch controls (MM) containing 4 nt changes are
`shown. (B) Reduction of PTEN mRNA expression in siRNA- and GeneBloc-transfected HeLa cells. HeLa cells were transfected with the indicated amounts
`of siRNA and GeneBloc as described. After 24 h, RNA was prepared and subjected to real time RT–PCR (Taqman) analysis to determine PTEN mRNA
`levels relative to p110a mRNA levels. Each bar represents triplicate transfections (6 SD). (C) Inhibition of PTEN protein expression analysed by
`immunoblot. The cells were harvested 48 h after transfection of the indicated amounts of GeneBlocs or siRNAs. Cell lysates were separated by SDS–PAGE
`and analysed by immunoblotting using anti-PTEN and anti-p110a antibody. The amount of p110a, a catalytic subunit of PI 3-kinase, was used as a loading
`control. Control cell extract from untransfected HeLa cells (UT) were loaded in the left lane.
`
`No overhang requirements of siRNA duplexes in
`mammalian cells
`
`Duplex length requirements of siRNA duplexes in
`mammalian cells
`
`The structural–functional relationship of siRNAs has been
`extensively studied biochemically using Drosophila melano-
`gaster embryo lysates (7,15). Using this system it has been
`demonstrated that duplexes with 2 nt 3¢ overhangs were the
`most efficient triggers of mRNA degradation (8,15,19). To test
`whether a similar dependence is true for mammalian cells, we
`transfected PTEN siRNA molecules with 3¢ or 5¢ overhangs or
`without overhangs into HeLa cells. Surprisingly, we did not
`observe a more efficient knock-down of target RNA with
`siRNAs containing 3¢ overhangs when compared to blunt
`molecules or those with 5¢ overhangs (Fig. 2A). Similar results
`were obtained for the second target p110b (Fig. 2C). To verify
`the observed mRNA knock-down, we performed an immuno-
`blot analysis using PTEN-specific antibodies (Fig. 2B). In
`these experiments the reduction of PTEN protein expression
`as well as the downstream phosphorylation of Akt1 kinase, a
`consequence of PTEN protein inhibition (16,17), was very
`similar with the different siRNA duplexes. We concluded
`from these data that 3¢ overhangs on synthetic siRNAs are not
`essential for RNAi in HeLa cells.
`
`We next examined the effects of duplex length variations on
`siRNA activity. For these experiments we used the Akt1
`kinase as a target. Duplexes of 19 nt length were highly
`efficient in reducing Akt1 mRNA levels independent of the
`nature (deoxyribonucleotides or ribonucleotides) of the 3¢
`overhang (Fig. 3A, compare molecules 1AB, 2AB, 3AB and
`4AB). This result is consistent with our observation that a 3¢
`overhang appears not to be crucial for siRNA function in HeLa
`cells. Next we reduced the duplex length to 17 nt (Fig. 3A,
`molecule 5AB). This molecule did show a dramatically
`reduced silencing activity, suggesting that active siRNA
`duplexes must have a minimal length (~19 nt), which is in
`agreement with experiments assessing activity of siRNA
`molecules with different duplex lengths in Drosophila extracts
`(15). This minimal duplex length for active siRNA molecules
`might be explained mechanistically by two different require-
`ments. First, a minimal base pairing between the antisense
`siRNA and the target mRNA may be obligatory or, second,
`incorporation into the RISC requires a minimal length of the
`siRNA duplex. To address this question we synthesised and
`
`(cid:143)
`(cid:143)
`(cid:143)
`

`

`2708 Nucleic Acids Research, 2003, Vol. 31, No. 11
`
`A
`
`B
`
`C
`
`Ratio PTEN/p11 Oc,;
`
`0
`
`"'
`
`025nM
`D5nM
`D1nM
`(cid:127) 0.2nM
`
`PTENlA
`PTENlB
`
`PTEN1.AMM
`PTENlBMM
`
`PTEN2A
`PTEN2B
`
`PTEN2AMM
`PTEN2BMM
`
`PT&N3A
`PTEN3B
`
`PTEN3l\MM
`PTEN3BMM
`
`s·
`cguuagcagaaacaaaaggag- TT
`3' TT-gcaaucgucuuuguuuuccuc
`•
`•
`•
`•
`s·
`cgu9a9cacaaa9aaaaugag- TT
`3 · TT-gcacuoguguuucuuuuacuc
`
`s·
`3'
`s·
`3•
`
`eguuagcagaaacaaaaggag
`9caauc9ucuuuguuuuccuc
`•
`•
`•
`•
`egugagoaoaaagaaaaugag
`gcacucguguuucuuuuacuc
`s· TT-oguu.agcagaaac:.aaaaggag
`9caaucgucuuuquuuuccuc• TT
`3·
`s·
`3'
`
`T
`"'
`T
`T
`TT-cgugagcacaaagaaaaugag
`geacucguguuueuuuuacuc- TT
`
`UT
`
`1AB
`
`1AB 2AB 2AB 3AB 3AB GB GB
`MM
`MM
`MM
`MM
`
`p1 10c,; - - - - - ---- -
`PTEN - --
`-
`-
`-
`P*-Akt - - - - - -
`
`1
`
`2
`
`3 4
`
`5
`
`6 7
`
`8
`
`9
`
`Ratio p110~ / p110c,;
`-,,.
`-...,
`(I) ~ -...,
`0
`0
`0
`
`0
`(l)
`
`0
`
`pllOPlA
`p11op10
`
`pllOPlAMM
`pllOPlBMM
`
`p110P2A
`pllOP2B
`
`pllOP3A
`p110P3B
`
`s ·
`uggaaugaaooacuggaauuu•TT
`3 · TT-accuuacuuggugaccuuaaa
`• • • ••
`•
`s·
`ugguaucaagcucaggaauau-TT
`3' TT-aceauag,.iucgaquccuuaua
`s ·
`3 '
`
`uggaaugaaccacuggaauuu
`accuuacuuggugaccuuaaa
`
`s·
`3 '
`
`TT-u99aau9aaccacu99aauuu
`accuuacuuggugaccuuaaa-TT
`
`UT
`
`0 1onM
`•1nM
`
`Figure 2. siRNA duplexes with a 3¢ or 5¢ overhang or without overhang (blunt) are equally potent in mediating gene silencing in HeLa cells. (A) Inhibition
`of PTEN mRNA expression in HeLa cells transfected with the indicated amounts of siRNA molecules. The sequences and different terminal structures of the
`siRNAs molecules are shown on the left. Mutations in the mismatch molecules are indicated by arrowheads. Samples were analysed in parallel for the level
`of PTEN mRNA expression 24 h after transfection by real time RT–PCR (Taqman) analysis. PTEN mRNA levels are shown relative to the mRNA levels of
`p110a, which served as internal reference. Each bar represents triplicate transfections (6 SD). (B) Inhibition of PTEN protein expression by use of siRNAs
`with different terminal structures. The cells were harvested 48 h after transfection of the indicated siRNAs (30 nM) (lanes 2–7) or GeneBlocs (30 nM) (lanes
`8 and 9). Cell extracts were separated by SDS–PAGE and analysed by immunoblotting using anti-p110a, anti-PTEN or anti-phospho-Akt antibody. The
`amount of p110a was used as a loading control and control cell extracts from untransfected HeLa cells (UT) were loaded in lane 1. (C) Inhibition of p110b
`mRNA expression in HeLa cells transfected with the indicated amounts of siRNA molecules. p110b mRNA levels are shown relative to the mRNA levels of
`p110a, which served as internal reference. The ratio of p110b/p110a mRNA of untransfected HeLa cells is shown at the bottom (UT). Each bar represents
`triplicate transfections (6 SD).
`
`transfected 19 nt long siRNA duplex molecules with one and
`two terminal mutations (CG and UA inversion) relative to the
`wild-type sequence (Fig. 3A, molecules 6AB and 7AB). Both
`
`molecules, even the molecule with a stretch of only 15 nt base
`pairing to the target mRNA, were functional in reducing the
`Akt1 mRNA level. We concluded from this result that the
`
`

`

`Nucleic Acids Research, 2003, Vol. 31, No. 11
`
`2709
`
`A
`
`Aktl lA
`Aktl 1B
`
`Aktl 2A
`Aktl 2B
`
`Aktl 3A
`Akt l 3B
`
`Aktl 4A
`Aktl 4B
`
`Akt l SA
`Aktl SB
`
`Ak tl 6A
`Aktl 6B
`
`Aktl 7A
`Aktl 7B
`
`PTBN lA
`P'l'EN 18
`
`P1'ENA
`P'l.'ENB
`
`P'l.'E>Mil
`PTE>M<l
`
`PTENl<H2
`P'l.'ENIK!
`
`B
`
`s ·
`cgaggggaguacaucaaga- uu
`3· uu-gcuccccucaugu.aguucu
`s·
`cgaggggaguacaucaaga-cc
`3 · uu-gcuccecuoauguaguuou
`s·
`ogaggggaguacauoaaga- CC
`3 · TT-9cuccccucauguaguucu
`s·
`ogaggggaguaoauoaaga- TT
`3 · TT- gcuccccucaugu.aguucu
`s·
`9a9999~gu.aeauca$g- •c
`3 • ug- cuccccucauguaguuc
`•
`•
`s·
`990.ggggogua.coucoogu- TT
`3 • TT- ccuccccucauguaguuca
`••
`••
`s·
`9ca999gaguaeoucaacu- TT
`3 · TT-cguocccucaugu.aguuga
`s ·
`cguuagcagaaacaaaaggag-TT
`3 · TT-gca.aucgucuuuguuuuoeuo
`
`Ratio Akt1 / p110a
`0
`
`0 ~ ~ -
`...
`- "' ;,.
`
`0 "
`
`-·m
`
`D25nM
`(cid:143) 5nM
`(cid:127) 1nM
`
`Duplex length
`
`19mer
`
`19mer
`
`19mer
`
`19mer
`
`17mer
`
`19mer(2MM)
`
`19mer(4MM)
`
`21mer
`
`UT
`
`S ' guuagcagaaacaaaagga
`3'caauc9ueuuu9uuuuoeu
`•
`S ' guuagcagaaagaaaagga
`3'caaucgucuuucuuuuccu
`• •
`S'guuageacaaagaaaagga
`3 ' caauoguguuucuuuuccu
`• •
`•
`S' guuaecaeaaagaaaagga
`3 ' caaugguguuucuuuuccu
`• • • •
`5 ' guuaccacaaagaauagga
`3 ' caaugguguuucuuauccu
`
`UT
`
`Ratio PTEN/p110a
`
`C
`
`D40nM
`o 20nM
`Cl 10nM
`D SnM
`
`p110a-
`
`PTEN -
`
`p110a-
`
`PTEN -
`
`PTEN PTEN
`MM1
`
`48 h -
`-
`
`96 h
`
`Figure 3. Duplex length requirement and tolerance for mutation in siRNAs in HeLa cells. (A) Inhibition of Akt1 mRNA expression in HeLa cells transfected
`with the indicated amounts of siRNA molecules. The sequences, lengths and different terminal structures (3¢ deoxyribonucleotides in upper case letters) of the
`siRNA molecules are shown on the left. The nucleotide changes in the mismatch siRNA molecule are indicated by arrowheads. Samples were analysed in
`parallel for the level of Akt1 and p110a mRNA expression 24 h after transfection by real time RT–PCR (Taqman) analysis. The mRNA levels of p110a served
`as internal reference. Each bar represents triplicate transfections (6 SD). (B) Inhibition of PTEN mRNA expression in HeLa cells transfected with the indi-
`cated amounts of siRNA molecules. The sequences of the corresponding siRNA molecules are shown on the left. (C) Inhibition of PTEN protein expression
`analysed by immunoblot. The cells were harvested 48 or 96 h after transfection of the indicated siRNAs (30 nM). Cell extracts were separated by SDS–PAGE
`and analysed by immunoblotting as described previously. The positions of PTEN and p110a, which was used as a loading control, are indicated on the left.
`
`duplex length itself, but not the base pairing of the antisense
`siRNA with the target mRNA, seems to determine the minimal
`length of functional siRNAs. These data suggest that the
`length of the double-stranded helix is an important determin-
`ant for incorporation into the RISC complex. Since the
`introduced mismatches at the terminal ends of the siRNA
`duplexes had little effect on RNAi, we wanted to analyse the
`effect of mismatches located in the centre of the molecule
`(Fig. 3B). For these experiments we used 19 nt long blunt
`siRNAs directed against PTEN mRNA. The sequence changes
`
`in one siRNA strand were compensated by complementary
`changes in the other strand to avoid disrupting duplex
`formation. A siRNA with only one point mutation in the
`centre of the molecule was severely compromised in its ability
`to reduce mRNA and protein expression levels (Fig. 3B and
`C). This result indicates that the RNAi machinery is highly
`discriminative between perfect and imperfect base pairing
`between target mRNA and siRNA in the centre of the duplex.
`The dependence on a perfect complementarity between target
`and siRNA has been investigated for RNAi before (13–15,19).
`
`

`

`2710 Nucleic Acids Research, 2003, Vol. 31, No. 11
`
`Effects on RNAi and siRNA stability of 5¢ and 3¢
`terminal modifications
`
`Having established the minimal structural requirements of
`siRNA duplexes, we wanted to test whether chemical end
`modifications can lead to more stabilised, active siRNA
`molecules. As a starting point we have used an inverted deoxy
`abasic (iB) modification (for details and structure see 16) and
`an amino end modification (NH2) (amino group with 6-carbon
`linker at the terminal phosphate; for details see 20). Similar
`end modifications have been successfully used to stabilise
`conventional antisense molecules and ribozymes (21) and are
`generally considered to protect
`therapeutic nucleic acids
`against serum-derived exonuclease activities (22). RNAi
`induction by siRNA duplexes with an NH2 or iB modification
`was dramatically reduced when all four termini were modified
`(Fig. 4A, compare molecule 1AB with 4AB and 5A5B).
`However, siRNA molecules which were modified only at the
`terminus of the sense strand showed no reduction in gene
`silencing activity (Fig. 4A, molecule 2B4A). Even siRNA
`molecules, which had no end protection at the 5¢-end of the
`antisense strand but on all other termini, showed no reduction
`in RNAi activity (Fig. 4A, molecules 6B4A and 7B4A). This
`result is in agreement with recently published results demon-
`strating the importance of the 5¢-hydroxyl group of the
`antisense strand for RNAi (20,23). In order to test whether the
`terminal modifications were capable of increasing stability in
`serum, we incubated the different siRNA duplexes at 37(cid:176)C in
`calf serum, followed by separation on 10% polyacrylamide
`gels. Surprisingly we were not able to detect any increase in
`stability or nuclease resistance (Fig. 4B). Neither the NH2 nor
`the iB end modification stabilised the siRNA duplexes
`significantly. This result suggests that siRNA molecules are
`degraded predominantly by serum-derived endonucleases. To
`test this hypothesis we synthesised siRNA duplex containing
`internal 2¢-O-methyl ribonucleotides at all positions, a com-
`monly used modification to increase stability of RNA-
`containing molecules (24). This internally modified molecule
`showed extreme resistance against degradation in our serum
`incubation assay (Fig. 4B, siRNA molecule at the bottom), and
`therefore might have better pharmacodynamic properties
`in vivo.
`
`Synthetic siRNA molecules with specific internal 2¢-O-
`methyl modification mediate RNAi and have increased
`stability in serum
`
`To identify synthetic siRNA molecules which have increased
`stability, but are also able to efficiently induce RNAi, we
`tested a series of molecules with 2¢-O-methyl residues at
`different positions (Fig. 5). siRNA molecules with either one
`or both strands consisting of 2¢-O-methyl residues were not
`able to induce RNAi in our mammalian system (Fig. 5A,
`molecules V2, V5 and V6). Similar results were observed with
`2¢-O-methyl-modified siRNAs in Drosophila lysates employ-
`ing a luciferase-based RNAi assay (15). However,
`the
`decrease in activity was less pronounced when only parts of
`the strands were modified. This result is in agreement with a
`recent study employing siRNAs, which were not modified in
`the core but contained different internal modifications at the
`terminal nucleotides of both strands (14). Interestingly, a
`molecule with an unmodified antisense strand (lower) and a
`
`completely modified sense strand was significantly more
`active when compared to the reversed version (Fig. 5A,
`compare molecules V5 and V6). This result suggests again
`that the antisense strand of the siRNA seems to be more
`critical and sensitive to modification. The most efficient
`molecules in reducing PTEN mRNA had only stretches of
`modification leaving the 5¢-end unmodified or were modified
`on alternating positions on both strands (Fig. 5A, molecules
`V10 and V12). At this point it was crucial to analyse the
`stability and activity of partially 2¢-O-methyl-modified siRNA
`molecules in more detail. To demonstrate nuclease resistance
`we incubated the different siRNA versions in serum followed
`by polyacrylamide gel electrophoresis. As shown before,
`blunt-ended siRNA molecules with unmodified ribonucleo-
`tides were very rapidly degraded whereas a complete substi-
`tution with 2¢-O-methyl nucleotides mediated resistance
`against serum-derived nucleases (Fig. 5B, compare molecule
`AB with V1). siRNA molecules with partial 2¢-O-methyl
`modification also showed an increased stability when com-
`pared to unmodified siRNAs. Especially, molecules with
`alternating modifications on both strands showed a significant
`improvement in stability (Fig. 5B, molecules V13, V14, V15
`and V12). More importantly, transfection of three of these
`molecules into HeLa cells did result in a significant down-
`regulation of PTEN protein expression (Fig. 5C, lanes 6, 9 and
`10). Detection of p110a protein by immunoblot was used as a
`loading control. In this RNAi activity assay we observed an
`unexpected preference for molecules which were modified at
`every second nucleotide beginning with the most 5¢ terminal
`nucleotide of the antisense strand (molecules V15 and V12).
`Molecules which contained modifications beginning with the
`second nucleotide at the 5¢ end of the antisense strand were
`more stable but had a strongly reduced activity in gene
`silencing (molecules V13 and V14). This result points towards
`highly specific interactions between the involved enzymes and
`precise nucleotides in the siRNA duplex. Taken together our
`data demonstrate that 2¢-O-methyl modifications at particu-
`larly selected positions in the siRNA duplex can increase
`nuclease resistance and do not necessarily abolish RNAi
`completely.
`An increased stability of synthetic siRNAs should primarily
`have implications for in vivo application, e.g. mouse models or
`in therapeutic applications of siRNA. Nevertheless we wanted
`to analyse whether the introduced modification can also lead
`to an extended protein knock-down in cell culture systems. In
`order to demonstrate this effect, we transfected HeLa cells
`transiently for 6 h using our cationic lipids with different
`versions of PTEN-specific siRNAs. The lipid siRNA complex
`was then washed away and the PTEN protein knock-down was
`analysed 48 and 120 h later. Generally knock-down experi-
`ments without continuous transfection of siRNAs are compli-
`cated due to rapid growth of untransfected cells in this time
`period resulting in a very transient knock-down (13).
`However, here we were able to demonstrate a prolonged
`PTEN protein knock-down with siRNA molecules stabilised
`by the described 2¢-O-methyl modifications. At 48 h post-
`transfection the unmodified siRNA (AB) shows the biggest
`reduction in PTEN protein levels; however, at 120 h post-
`transfection the reduction in PTEN protein expression is
`superior with the siRNAs stabilised by alternating 2¢-O-
`methyl modifications (Fig. 5D, compare lane 2 with lanes 4,
`
`

`

`Nucleic Acids Research, 2003, Vol. 31, No. 11
`
`2711
`
`Ratio PTEN/p110a
`
`5 '
`3'
`
`cguuagcagaaacaaaaggag- TT
`TT- gcaaucgucuuuguuuuccuc
`
`NH2 - cguuagcagaaacaaaaggag- TT-NH2
`5 '
`3 ' NH2 - TT- gcaaucgucuuuguuuuccuc-NH2
`
`5 '
`3'
`
`iB- cguuagcagaaacaaaaggag- TT- iB
`iB- TT- gcaaucguc uuuguuuuccu c- iB
`
`5 '
`3 '
`
`NH2- cguuagcagaaacaaaaggag- TT-NH2
`i B- TT- gcaauc guc uuuguuuuccu c
`
`NH2- cguuagcagaaacaaaaggag- TT-NH2
`5 '
`3 ' NH2- TT- gcaaucgucuuuguuuuccuc
`
`5 '
`3 '
`
`5'
`3 '
`
`NH2- cguuagcagaaacaaaaggag- TT-NH2
`TT-gcaaucguc uuuguuuuccuc
`
`NH2-cguuagcagaaacaaaaggag-TT-NH2
`gcaaucgucuuuguuuuccuc
`
`UT
`
`stability
`Serum O' 15' 120'
`
`activity
`
`A
`
`PTENl A
`PTENl B
`
`PTEN4A
`PTEN4B
`
`PTEN5A
`PTEN5B
`
`PTEN4A
`PTEN6B
`
`PTEN4A
`PTEITTB
`
`PTEN4A
`PTENlB
`
`PTEN4A
`PTEN2B
`
`B
`
`- - - - -TT
`TT - - - - -
`
`TT
`
`iB-
`iB-TT
`
`NH2 -
`NB,-TT
`
`NHz- TT
`
`TT
`
`TT- iB
`-iB
`
`TT-NB2
`- NH2
`
`TT-NH2
`
`llll lll'IIIIIII TT
`TT jjjj j j jj jjjjjj f
`
`+++
`
`+++
`
`+++
`
`-
`-
`
`+++
`
`-
`
`Figure 4. RNAi activity and stability in serum of modified siRNA molecules. (A) Activity of siRNA with modified termini. 19mer duplex siRNAs specific
`for PTEN mRNA were synthesised with 2 nt deoxythymidine (TT) 3¢ overhangs or without overhangs. iB represents inverted deoxy abasic end modifications,
`NH2 represents end protection with amino-C6 linker at the terminal phosphates. Inhibition of PTEN mRNA expression in HeLa cells transfected with the
`indicated amounts of modified siRNA molecules was determined by Taqman analysis as described before. (B) Stability assay of siRNAs with different
`chemical modifications. The structure of the modified siRNA molecules are schematically shown on the left. The siRNA molecule at the bottom was
`synthesized with 2¢-O-methyl ribonucleotides (A, G, U and C) at all positions, indicated by IIIIII. Polyacrylamide gel (10%) electrophoresis of the indicated
`siRNA molecules after incubation in serum as described in Materials and Methods.
`
`

`

`2712 Nucleic Acids Research, 2003, Vol. 31, No. 11
`
`A
`
`Ratio PTEN/p110a
`
`.,
`
`w
`
`0
`
`UT
`
`PTEN 2A
`PTEN 2B
`
`S • cguua9cageoocaa.aa9 gag
`3 · gcaaucgucuuuQuuuuecuc
`
`PTEN2AMM 5 • C9ll9A9(:1"caaa9Aa.aAu9.,9
`PTEN28MM 3 • gcacucguguuucuuuuac uc
`
`PTENV1
`
`5 . ~2£!2:&UCH.&IISISllllS,:
`J ' ~IUJOCIIJCUUUCNUUUOCUC
`
`PTENV2
`
`5 . CQUU~~IHlAC.!IM~ iQ
`J . QC&AUOIJUCUU~WUOC'UC
`
`PTENV3
`
`5' c9uu!9:C:!51:aa&e-.a~9ag
`J · ocaaU()(lUCUu~\NUOCUC
`
`PTENV4
`
`5 • C9\lU.S9C40UAC.U.1&.,9gAg
`3' gcaai.K.~UCCUC
`
`PTENV5
`
`5 • 9l!:!!:!!;2C!2_!a.c•u•S12"SI:
`3 • gc;.ao)U~\!Cuuuguuuuocuc
`
`PTENV6
`
`5 · c9Uuaocaqaaacaa.aaq9a9
`3 ' qcuuoqucuuuquuuuocuc
`
`PTENV7
`
`5 • cquupoc:pgauc:atuu1ggag
`J · gcaaucqucuuugu\Nuoeuc
`
`PTENVS
`
`5 • cguuagcagaaacw:'99!'9
`3 · geaauoquouuu9uuuuccuc
`
`PTENV9
`
`S · 9l!!!:!!5lei1S[aaa.ca..-asm:all
`J • 9C44UC~
`UtlU(."CUC
`
`PTEN V10 5 · cguuaoe~
`J '~UCllV~
`
`caa.a!.i!l!i
`UOCUC
`
`PTENV11 5 • 0Cl'UUaOC!Slau.caaaaSISl!51:
`J'ocaau~
`uocuc
`
`PTEN V12 S ' S.9!.