Nucleic acids research.
`v. 31, no. 11 (June 1 2003)
`General Collection
`W1 NU12.4
`2003-06-23 O7'25:45
`
`x/r-ii 1 IktM
`
`P1/4" IMBER 11 JUNE 1, 2003
`
`is Acids
`Research
`
`NAR
`ONLINE
`
`http://www.nar.emploureals.ors
`
`Transcription
`Endonucelase activity
`
`Packaging
`
`Replication
`
`NAVIONAL
`LIBRARY OF
`ME1)1GINE
`
`rI) IIOATR1161:I 3\FI TAT
`LIBRARY OF
`MEDICINE
`
`NI
`
`4
`
`Cr,
`0'
`0'
`
`u,
`
`ITY PRESS
`
`This materra—Wais copied
`ay be
`41
`Subject US Copyright Laws
`
`' t A0
`
`Alnylam Exh. 1028
`
`04057Z-1 NUCLEIC ACIDS RESEARCH
`2063 VOLUME 31 ISSUE 11
`S ISAC
`
`00
`
`CD
`
`CU
`"4-
`
`O
`
`IND
`5219701
`
`C)
`CIO"
`
`(cid:9)
`(cid:9)
`

`

`Subscriptions
`
`Nucleic Acids Research is published twice monthly (24 issues per year).
`Subscriptions are entered on a calendar year basis only and are available as a
`printed version (including online access) or as online access only at a discount of
`10% (+VAT in UK). Prices include postage by surface mail or, for subscribers in
`the USA and Canada by air freight, or in India, Japan. Australia and New Zealand.
`by Air Speeded Post. Airmail rates are available on request.
`
`Annual subscription rate (Volume 31, 2003):
`Insritutionai
`Print and Online site licence: UK and Europe £1365, Rest of World $2360.
`Personal
`Print and Online: UK and Europe £365, Rest of World $621.
`Back volume prices arc available on request. Please add sales tax to the prices
`quoted.
`
`Orders, Orders and payments from, or on behalf of, subscribers in the various
`geographical areas shown below should he sent to the Press office indicated.
`
`The Americas: Oxford University Press Inc.. 2001 Evans Road. Cary, NC 27513.
`USA.
`
`Rest of the World: Journals Subscriptions Department, Oxford University Press.
`Great Clarendon Street, Oxford OX2 6DP, UK.
`Tel: (+441865 or 01865) 353907; Fax: (+441865) 353485;
`Entail: jnl.ordersontip.co.tik
`
`Advertising. To advertise in Nucleic Acids Research contact Oxford University
`Press (US office) in the Americas or Oxford University Press (UK office) in the
`Rest of the World (see addresses above).
`
`Oxford University Press 2003. All rights reserved; no pan of this publication
`may be reproduced. stored in a retrieval system, or transmitted in any form or by
`any means, electronic, mechanical, photocopying, recording, or otherwise without
`either prior written permission of the Publishers, or a licence permitting restricted
`copying issued in the UK by the Copyright Licensing Agency Ltd. 90 Tottenham
`Court Road, London WM 9HE, or in the USA by the Copyright Clearance Center,
`222 Rosewood Drive, Danvers, MA 01923. USA.
`
`Back volumes of this journal are available in 16 min microfilm, 35 non microfilm
`and 105 microfiche from University Microfilms International, 300 North Zeet,
`Road, Ann Arbor, MI 48106-1346, USA. Copies of articles published are also
`available from UNIT.
`
`Nucleic Acids Research (ISSN 0305-1048) is published twice monthly by Oxford
`University Press, Oxford, UK. Annual subscription price is US$2360. Nucleic
`Acids Research is distributed by Mercury International. 365 Blair Road, Avenel,
`NJ 07001, USA. Periodicals Postage Paid at Rahway, NJ, USA and additional
`entry points.
`
`US POSTMASTER: send address corrections to Nucleic Acids Research, efo
`Mercury Airfreight international Ltd. 365 Blair Road, Avenel, NJ 07001, USA.
`
`Typeset and printed by Information Press Ltd. Oxford, UK on acid-free paper.
`
`Cover: Two promoter structures of influenza A virus. The upper one is the viral promoter and the lower one is the cRNA
`promoter, which is the replicative intermediate. The working hypothesis from our work is that the same RdRp regulates viral
`replication by interacting with distinct hut similar promoter structures. The internal loops of both RNA promoters provide
`common protein binding sites. However, the structural and dynamic differences within the vRNA and cRNA promoters may
`induce two distinct RNP conformations. For further information see the paper by Park et al. in this issue [Nucleic Acids Res.
`(2003) 31, 2824-28321.
`
`This material wascopied
`at the NLM and may be
`Subject US Copyright Laws
`
`

`

`clleic Acids Research
`
`Volume 31 number 11, June 1, 2003
`
`Contents (cid:9)
`
`CHEMISTRY
`
`Syntheses and structural studies of ealix[4]arene—
`nucleoside and cali441arene—oligonucleolide hybrids
`
`S.J.Kim and B.H.Kim
`
`2725-2734
`
`S (cid:9)
`
`Steric inhibition of human intmunodeficieney virus
`type-1 Tat-dependent trans-activation in van) and in
`cells by oligonuclentides containing 2`.0-methyl
`0-clamp ribunueleoside analogues
`
`COMPUTATIONAL BIOLOGY
`
`Jl (cid:9) Using structural motif templates to identify proteins
`with DNA binding function
`
`SPINE 2: a system for collaborative structural
`proteomics within a federated database framework
`
`jty (cid:9)
`
`Integrated functional and bioinformatics approach for
`the identification and experimental verification of
`RNA signals: application to HIV-1 INS
`
`ri (cid:9)
`
`Efficient clustering of large EST data sets on parallel
`computers
`
`GENOMICS
`
`S.C.Holmes, A.A.Arzumanov and M.I.Gait
`
`2759-2768
`
`S.Jones,1.A.Barker, l.Nobeli and J.M.Thornton
`
`2811-2823
`
`C.-S.Goh, N.Lan, N.Echols, S.M.Douglas, D.Milburn, (cid:9)
`P.Bertone, R.Xiao, L.-C.Ma, D.Zheng, Z.Wunderlich,
`T.Acton, GT,Montelione and M.Gerstein
`
`2833-2838
`
`H.Wolff, R.Brack-Werner, M.Neumann, T.Wemer and (cid:9)
`R.Schneider
`
`2839-2851
`
`A.Katyanaraman, S,Alum, S.Kodiari and V.Brendel (cid:9)
`
`2963-2974
`
`Faithful expression of a tagged MTH WT1 protein
`from a genomic transgene in zebrafish: efficient
`splicing of pufferfish genes in zebrafish but not mice
`
`C.G.MRes, L.Rankin, (cid:9)
`N.D.Hastie
`
`M.Niksie, G.Elgar and (cid:9)
`
`2795-2802
`
`MOLECULAR BIOLOGY
`
`Transcriptional regulation of the human MW-la
`promoter by RUNX1 and MOZ
`
`C.A.P.Bristow and P.Shore (cid:9)
`
`Effect of DNA bases and backbone on 070 holoenzyme
`binding and isomeritation using fork junction probes
`
`M.S.Fenton and I.D.Gralla (cid:9)
`
`Overcxpression of FABP7 in Down syndrome fetal
`brains is associated with PKNOKI gene-dosage
`imbalance
`
`Domain mapping of Escherichia coil RecQ defines the
`roles of conserved N- and C-terminal regions in the
`RecQ family
`
`UVA-induced cyclobutane pyrimidinc (timers form
`predominantly at thymine—thyrnine dipyrimidines and
`correlate with the mutation spectrum in rodent cells
`
`M.F.Stinchez-Font, A.Bosch-Comas, R.Gonxiilez-Duarte (cid:9)
`and G.Marfany
`
`D.A.Bemsteitt and 1.L.Keck (cid:9)
`
`R.Drnuin, D.Perdiz,
`P.J.Rochette, (cid:9)
`N.Bastien, E.A.Drobeisky and E.Sage
`
`Purification and characterisation of a novel 1)NA
`mclityltransferase, M.AlidE
`
`P.Marks, .1.McGeehan, G,Wilson, N,Errington and (cid:9)
`G.Kneale
`
`2735-2744
`
`2745-2750
`
`2769-2777
`
`2778-2785
`
`2786-2794
`
`2803-2810
`
`Continued
`
`This material was copied
`at the NLM and maybe
`Subject US Copyright Lens
`i
`
`

`

`Contents (Continued)
`
`•
`
`•
`
`The Drosophila Corti protein interacts with
`Polycomb-group proteins and the GAGA factor
`
`Experimental and computational analysis of
`transcriptional start sites in the cyanobacterium
`Prochlorocorcas MED4
`
`ZBP-89 represses vimentin gene transcription by
`interacting with the transcriptional activator, Spl
`
`A new member of the MCIVI protein family encoded
`by the human MeM8 gene, located contrapodal to
`GCDIO al chromosome band 20p12.3-1.3
`
`A novel engineered meganuclease induces homologous
`recombination in yeast and mammalian cells
`
`RNA
`
`Structural variations and stabilising modifications of
`synthetic siRNAs in mammalian cells
`
`Insight into the mechanism of the peptide-haled gene
`delivery system MPG: implications for delivery of
`siRNA into mammalian cells
`
`'the phage T4 restriction endorihonuelease RegII:
`a eyelizing enzyme that requires two histidines to be
`fully active
`
`Tertiary structure base pairs between D- and
`Tye-loops of Escherichia roll IRNAL" play important
`roles in both aminnacylution and editing
`
`Optimisation of the 10-23 DNAzyme-substrate pairing
`interactions enhanced RNA cleavage activity at
`purine-cylosine target sites
`
`Volume 31 number 11, June 1, 2003
`
`J.Salvaing. Alopez, A.Boivin, J.S,Deutsch and
`FTeronneu
`
`J.Vogel, I.M.Asmann, H.Herzel and W.R.Hess
`
`X.Zhang. I.H.Diah and Z.E.Zehner
`
`E.M.Johnson, Y.Kinoshita and D.C.Danicl
`
`S.Arnould, P.Chames, P.Rochais, (cid:9)
`D.Desfontaines, C.Puzin, A.Patin, A.Zanghellini, F.Paques
`and E.Lacroix
`
`F.Czautlema, M.Fechtner, S.Dames, H.Ayglin, A.Klippel,
`G.J.Pronk, K.Giese and ].Kaufmann
`
`F.Simeoni, M.C.Mnrris, F.Heitz and G.Divita
`
`F.Salda. M.Dzaru and F.Bontems
`
`X.Du and E.-DAVang
`
`2873-2882
`
`2890-2899
`
`29(10-2914
`
`2915-2925
`
`2952-2962
`
`2705-2716
`
`2717-2724
`
`2751-2758
`
`2865-2872
`
`M.I.Cairns, A.King and L-Q.Sun
`
`2883-2889
`
`S Exploring the repertoire of RNA secondary motifs
`using graph theory; implications for RNA design
`
`H.H.Gan, S.Pasquali and T.Schlick
`
`2926-2943
`
`STRUCTURAL BIOLOGY
`
`Solution structure of the influenza A virus cl2NA
`promoter: implications for differential recognition of
`viral promoter structures by RNA-dependent RNA
`polymerase
`
`The role of intercalating residues in chromosomal
`high-mobility-group protein DNA binding, bending
`and specificity
`
`S Specific interactions of distamycin with 6-quadruples
`DNA
`
`METHODS
`A novel helper plunge that improves phage display
`selection efficiency by preventing the amplification of
`plunges without recombinant protein
`
`C.-J.Park, S.-H.Bae, (cid:9)
`
`G.Varani and B.-S.Choi
`
`2824-2832
`
`J.Klass, E.V.Murphy 1V, &Fouts, M.Serenil, A.Changela,
`J.Siple anti M.E.A.Churchill
`
`2852-2864
`
`M.J.Cocen, L.A.Hanakahl, M.D.Huber and N.IVIaizels
`
`2944-2951
`
`R.A.Kramer, F.Cos, M.van der Horst,
`S.van den Oudenrijn, P.C.M.Res, J.Bia, T.Logtcnbcrg and
`J.dc Kniif
`
`e59 (9 pp.)
`
`Court/nit&
`
`I
`
`This material %sea copied
`at the NUN and may ere
`Subject US Copyright Laws
`
`ii
`
`(cid:9)
`(cid:9)
`(cid:9)
`(cid:9)
`(cid:9)
`(cid:9)
`(cid:9)
`

`

`Contents (Continued)
`
`Volume 31 number 11, June 1, 2003
`
`Use of a three-color eDNA microarray platform to
`measure and control support-bound probe for
`improved data quality and reproducibility
`
`Precise determination Of mitochondria' DNA copy
`number in human skeletal and cardiac muscle by a
`PCR-based assay: lack of change of copy number with
`age
`
`A novel multiplex quantitative DNA array based l'CR
`(MQDA-PCR) for quantification of transgenic maize
`in food and feed
`
`MALDI mass spectrometry analysis of single
`nucleotide polymorphisms by photocleavage and
`charge-tagging
`
`M..1Messner, X.Wang. S.Khan. L.Mcycr, M.Schlicht. (cid:9)
`J.Tackes. M.W.Datta, H.J.Jacoh and S.Ghosh
`
`c60 (9 pp.)
`
`F.I.Miller, F.L.Rosenfeldt, C.Zhang, A.W.Linnane and (cid:9)
`P.Nagley
`
`e61 (8 pp.)
`
`K.Rudi, I.Rud and A.Floick (cid:9)
`
`e62 (8 pp.)
`
`S.Sauer. H.Lcliruch and R.Reinhardt (cid:9)
`
`e63 (10 pp.)
`
`In vitro analysis of nuclear niRNA export using
`molecular beacons for target detection
`
`R.II.Kchlenhacit (cid:9)
`
`An automated microplate-based method for
`monitoring DNA strand breaks in plasmids and
`bacterial artificial chromosomes
`
`Genotyping single nucleotide polyntorphisms directly
`from genomic DNA by invasive cleavage reaction on
`microsplieres
`
`AUTHOR INDEX
`
`Ze4 cmaains a novel method
`S, Supplementary Material rivailable at NAR Online
`
`C.Rock, P.Ayazi Shamlou and M.S.Levy (cid:9)
`
`e64 (8 pp.)
`
`c65 (6 pp.)
`
`K.V.N.Rao, P.Wilkins Stevens, J.G.1-14, V.LyanUcliev, (cid:9)
`B.P.Neri and D.M.Kelso
`
`e66 (8 pp.)
`
`This material was copied
`at the NLM and may be
`Subject US Copyright Laws
`(cid:76)(cid:76)i
`
`(cid:9)
`

`

`Nucleic Acids Research, 2003, Vol. 31, No. II 2705-2716
`DOI: 10.1093InarIgkg393
`
`Structural variations and stabilising modifications of
`synthetic siRNAs in mammalian cells
`Frank Czauderna, Melanie Fechtner, Sibylle Dames, Hilseyin Aygunl, Anke Klippel,
`Gijsbertus J. Pronk, Klaus Giese and Jorg Kaufmann*
`
`Atugen AG, Otto Warburg Haus (No. 80), Robert-Roessle-Strasse 10, 13125 Berlin, Germany and 1BioSpring,
`Hanauer Landstrasse 526, 60386 Frankfurt, Germany
`
`Received March 20, 2003; Revised and Accepted April 11, 2003
`
`ABSTRACT
`Double-stranded short interfering RNAs (siRNA)
`induce post-transcriptional silencing in a variety of
`biological systems. In the present study we have
`investigated the structural requirements of chemic-
`ally synthesised siRNAs to mediate efficient gene
`silencing in mammalian cells. In contrast to studies
`with Drosophila extracts, we found that synthetic,
`double-stranded siRNAs without specific nucleotide
`overhangs are highly efficient in gene silencing.
`Blocking of the 5'-hydroxyl terminus of the anti-
`sense strand leads to a dramatic loss of RNA inter-
`ference activity, whereas blocking of the 3' terminus
`or blocking of the termini of the sense strand had
`no negative effect. We further demonstrate that syn-
`thetic siRNA molecules with internal 2'-0-methyl
`modification, but not molecules with terminal modi-
`fications, are protected against serum-derived
`nucleases. Finally, we analysed different sets of
`siRNA molecules with various 2'-0-methyl modifica-
`tions for stability and activity. We demonstrate that
`2'-0-methyl modifications at specific positions in
`the molecule improve stability of siRNAs in serum
`and are tolerated without significant loss of RNA
`interference activity. These second generation
`siRNAs will be better suited for potential therapeutic
`application of synthetic siRNAs in vivo.
`
`INTRODUCTION
`The term RNA-mediated interference (RNAi) was initially
`introduced by Fire and co-workers (1) to describe the
`observation that injection of double-stranded RNA (dsRNA)
`into the nematode Caenorhabditis elegans can block expres-
`sion of genes highly homologous in sequence to the delivered
`dsRNA. RNAi is evolutionarily conserved among cukaryotes
`and it appears to have an essential role in protecting the
`genome against invasion by pathogens such as viruses, which
`generate dsRNA molecules upon activation and replication
`(2). Most recently two independent studies demonstrated that
`the yeast RNAi machinery is required for the formation and
`
`maintenance of heterochromatin during mitosis and meiosis,
`indicating additional functions for RNAi (3,4). In the past,
`repression of genes by long dsRNAs has been less successful
`in mammalian cells with the exception of embryonic cells
`(5,6). Use of short (<30 nt) synthetic dsRNAs allowed for
`sequence-specific gene silencing yet avoided the non-selective
`toxic effects of long dsRNAs in differentiated mammalian
`cells (7). This discovery triggered a much wider interest in the
`RNAi phenomenon since it provides a new avenue for loss of
`function studies in somatic cells of vertebrates. Initial studies
`with these small interfering RNAs (siRNAs) demonstrated
`that the duplex must have 2 or 3 nt overhanging 3' ends for
`efficient cleavage destruction of the target mRNA (8). The 3'
`overhangs can be generated by cleavage of long dsRNA into
`siRNAs by a multidomain RNase III-like enzyme, known as
`Dicer (9). In a subsequent step the siRNA associates with the
`RNAi-induced silencing complex (RISC), which is then
`guided to catalyse the sequence-specific degradation of the
`mRNA (9-11).
`RNAi induced by synthetic siRNAs is transient, and in
`mammalian cell culture systems re-expression of the target
`mRNA usually occurs after a few days (12,13). Therefore an
`improvement in the intracellular and extracellular stability of
`the effector molecules will be one crucial aspect for the
`successful in vivo application of synthetic siRNAs. A variety
`of chemical modifications, including terminal and internal
`modifications (e.g. 2'43-modification or phosphorothioate
`linkages), have been tested to see whether they influence
`RNAi inducing activity (7.8,13-15). However, these studies
`did not adequately assess the effect of the different modifi-
`cations on sensitivity of these molecules to siRNA-degrading
`serum-derived nucleases.
`In the present work we define the minimal structural
`requirements of siRNAs in mammalian cells and test a series
`of chemical modifications to improve the stability of siRNAs
`for future in viro applications. To determine differences in
`potency, we measured the inhibition of expression of several
`targets, including PTEN, p HOD and Akt 1, which are all
`members of the phosphatidylinositol (PI) 3-kinase pathway
`(16,17). Surprisingly, we found no overhang dependence of
`the siRNA duplexes in HeLa cells, which is in contrast to
`observations made in the Drosophila system (15). We have
`established the minimal required size for functional siRNAs in
`WU cells and have developed functionally active siRNA
`
`*To Whom correspondence should be addressed. Tel: +49 30 9489 2833; Fax: +49 30 9489 2801; Email: kaufmann@atugen.com
`
`Nucleic Acids Research, Vol. 31 No. I1 © Oxford University Press 2003; all rights reserved
`
`This material was copied
`
`

`

`2706 Nucleic Acids Research, 2003, Vol. 31, No. 11
`
`molecules with increased nuclease resistance. Our results
`provide a basis for the further development of synthetic siRNA
`molecules with improved characteristics, including higher
`resistance to serum-derived endonucleases.
`
`MATERIALS AND METHODS
`
`Synthetic siRNAs and GeneBlocs
`Synthetic siRNAs were purchased from BioSpring (Frankfurt,
`Germany). The oligoribonucleotides were resuspended in
`RNase-free TE to a final concentration of 50 p.M. In the case of
`bimolecular siRNA molecules, equal aliquots (100 p.M) were
`combined to a final concentration of 50 p.M. For the formation
`of duplexes the siRNAs were incubated at 50°C for 2 min in
`annealing buffer (25 mM NaCI, 5 mM MgC12) and were
`cooled down to room temperature. The PTEN-specific
`the schematic structure cap-
`Gene Blocs used have
`nnnnnnNNNNNNNNnnnnnn-cap, as published previously
`(16), where cap represents an inverted deoxy abasic modifi-
`cation, n stands for 2`-0-methyl ribonucleotides (A, G, U or C)
`and N represents phosphorothioate-linked deoxyribonucleo-
`tides (A, G, T or C).
`
`Cell culture and transfections
`
`The particular HeLa cell line used in the experiments
`presented was a gift from M. Gossen (MDC, Berlin,
`Germany) and was grown in Eagle's minimum essential
`medium with 2 mM L-giutamine, Earle's balanced salt
`solution, 1 mM sodium pyruvate, 0.1 mM non-essential
`amino acids and 10% fetal bovine serum (FBS). Synthetic
`siRNA and antisense GeneBloc transfections were carried out
`in 96-well or 10 cm plates (at 30-50% confluency) by using
`cationic lipids such as Oligofectamine (lnvitrogen, Carlsbad,
`CA) or NC388 (Atugen, Berlin, Germany) as reported
`previously (16). HeLa cells were transfected by adding a
`pre-formed 5X concentrated complex of siRNAs and lipid in
`serum-free medium to cells in complete medium. The total
`transfection volume was 100 pl for cells plated in 96-wells and
`10 ml for cells in 10 cm plates. The final lipid concentration
`was 0.8-1.2 pg/m1 depending on cell density; the siRNA
`concentration is indicated in each experiment.
`
`Antibodies and immunoblotting
`
`Cell lysates were prepared and aliquots of the cell extracts
`containing equal amounts of protein were analysed by
`immunoblotting as described previously (16,17). The murine
`monoclonal anti-pl 10a antibody has been described (18).
`Rabbit polyclonal anti-Akt and anti-phospho-Akt (S473)
`antibodies were obtained from Cell Signalling Technology.
`The murine monoclonal anti-PTEN antibody was from Santa
`Cruz Biotechnology.
`
`Quantitation of mRNA by Tagman analysis
`The RNA of cells transfected in 96-wells was isolated and
`purified using the lnvisorb RNA HTS 96 kit (InVitek GmbH,
`Berlin, Germany). Inhibition of targeted mRNA expression
`was detected by real time RT—PCR (Taqman) analysis using
`300 nM 5' forward primer, 300 nM 3' reverse primer and
`100 nM Fam-Tamri-labelled Taqman probe. The gene-
`specific primer sequences can be obtained on request. The
`
`reaction was carried out in 50 pl and assayed in an ABI
`PRISM 7700 Sequence detector (Applied Biosystems) accord-
`ing to the manufacturer's instructions under the following
`conditions: 48°C for 30 min, 95°C for 10 min, followed by
`40 cycles of 15 s at 95°C and 1 min at 60°C.
`
`Nuclease resistance assay
`For the stability assay 5 pl of (2.5 p.M) siRNA was incubated
`in 50 p.1 of fetal bovine serum for 15 or 120 min at 37°C. The
`solution was extracted with phenol and siRNA was precipi-
`tated with ethanol and separated on 10% polyacrylamide gels
`followed by ethidium bromide staining. Equal amounts of
`siRNA before serum incubation (0 min) was extracted with
`phenol in parallel and loaded as an input control.
`
`RESULTS
`
`Comparison of synthetic siRNAs and antisense molecules
`in HeLa cells
`As most published studies with siRNA in mammalian cells
`have involved the knock-down of ectopically or abundantly
`expressed genes, we first set out to demonstrate that synthetic
`siRNAs can be efficient tools in reducing endogenous mRNA
`and protein levels. For this purpose we designed and analysed
`siRNA molecules specific for the tumour suppressor PTEN.
`For comparison and as a positive knock-down control, we
`employed in parallel conventional antisense molecules
`containing the same nucleotide sequences. The antisense
`molecules, here called GeneBlocs, consisted of nine internal
`deoxyribonucleotides for activation of RNase H flanked by six
`2`-0-methyl-modified ribonucleotides, whereas the siRNAs
`used consisted of two 21mer ribonucleotides with two
`deoxythymidine nucleotides at the 3' termini (Fig. IA). The
`double-stranded siRNA as well as the single-stranded
`GeneBlocs are identical in length (21mer + terminal modifi-
`cations). To control for non-specific transfection effects, we
`included mismatch sequences as negative controls. HeLa cells
`were transfected with increasing amounts of these molecules
`and the PTEN mRNA level was analysed 24 h later by real
`time PCR (Taqman). The maximal reduction of PTEN mRNA
`normalised to the mRNA of p 1 10a, one of the catalytic
`subunits of PI 3-kinase, was reached with 2.2 nM siRNA and
`20 nM GeneBloc (Fig. 1B). To verify the result on the mRNA
`level, we analysed protein reduction induced by antisense
`GeneBloc and siRNA transfection in a second set of experi-
`ments. HeLa cells were transfected with increasing amounts of
`these molecules and cell lysates were analysed 48 h later by
`immunoblot analysis using PTEN-specific antibodies. p110a
`protein level served as a loading control (Fig. 1C). Maximal
`PTEN protein knock-down was detected with 2.5 nM
`siRNA and 15 nM GeneBloc. These experiments demonstrate
`that siRNA molecules can efficiently reduce mRNA and
`protein levels of endogenous genes. Furthermore, these
`siRNAs can be more efficient in mediating mRNA
`reduction when compared to conventional antisense molecules
`directed against the same target sequence. The observed
`differences in efficacy may he due to different mechanisms
`of target recognition and/or degradation and may reflect
`the involvement of more efficient catalytic steps in the case
`of RNAi.
`
`This material Was copied
`at the N LIM and may he
`Subject US Copyright Laws
`
`

`

`Nucleic Acids Research, 2003, Vol. 31, No. I1 2707
`
`35nM
`8,75nM
`0 2,2nM
`0,55nM
`0,13nM
`• 0 03nM
`
`El 40nIVI
`Cj 20nM
`10nM
`5nM
`
`siRNA
`
`UT PTEN PTEN
`1AB 1ABMM
`
`GeneBloc
`
`UT PTEN PTEN
`GB GBMM
`
`1,2 (cid:9)
`1
`0,8 -
`0.6 -
`0,4
`0,2 -
`
`1,2 (cid:9)
`
`0,8
`0,6
`0,4
`0,2
`0
`
`Ratio PTEN / p110a
`
`Ratio PTEN I pl lea
`
`B
`
`A
`
`C
`
`PTEN1A (cid:9)
`PTEN18 (cid:9)
`
`PTENIAMM (cid:9)
`PTEN1BM4 (cid:9)
`
`cquuagcagnamcaamaggag-TT
`3' TT-geramegucuulsguuuuccue
`
`V V V V
`cgugavacaaagatamaugag-TT
`TT-gancuesnaguuutuulluBauc
`
`?TEN GB (cid:9)
`
`PTEN G5t'5 (cid:9)
`
`5' (cid:9)
`
`5' (cid:9)
`
`iB-cmcguuTTCTTTCTGcunacg-i8
`
`VYVV
`iB-cmcauuTTETTTGTGBucacq-i8
`
`GeneBloc (cid:9)
`
`siRNA
`
`UT 0.9 3.7 15 60 0.15 0.6 2.5 10 nM
`
`p11 OCL — (cid:9)
`
`.....
`
`PTEN — ammo._ •••••
`
`1 2 3 4 5 6 7 8 9
`
`Figure 1. mRNA and protein knock-down of endogenous PTEN and induced by transfectien of siRNA or GeneIlloe (GB, antisense) in HeLa cells. (A) The
`sense (A) and antisense (B) strands of siRNA targeting human PTEN mRNA are shown in comparison to the corresponding GeneBloc (antisense molecules).
`siRNAs were synthesised with 2 nt deoxythymidine (TT) 3' overhangs. GcneBlocs representing the third generation of antisense oligonucleotides with
`inverted abasic (ID) end modifications (see Materials and Methods). The sequences of the respective mismatch controls tMM) containing 4 nt changes are
`shown. (II) Reduction of PTEN mRNA expression in siRNA- and GeneBloc-transfected HeLa cells. HeLa cells were transfected with the indicated amounts
`of siRNA and Genefiloc as described. After 24 h, RNA was prepared and subjected to real time RT—PCR (Taman) analysis to determine PTEN niRNA
`levels relative to ph lOcc mRNA levels. Each bar represents triplicate transfections (I' SD). (C) inhibition of PTEN protein expression analysed by
`immunoblot. The cells were harvested 48 h after transfection of the indicated amounts of GeneMocs or siRNAs. Cell lysates were separated by SOS—PAGE
`and analysed by immunobioning using anti-PTEN and anti-pl 10a antibody. The amount of p1 10a, a catalytic subunit of P1 3-kinase, was used as a loading
`control. Control cell extract from untransfectes.1 HeLa cells (UT) were loaded in the left lane.
`
`No overhang requirements of siRNA duplexes in
`mammalian cells
`The structural—functional relationship of siRNAs has been
`extensively studied biochemically using Drosophila melano-
`gaster embryo lysates (7,15). Using this system it has been
`demonstrated that duplexes with 2 nt 3' overhangs were the
`most efficient triggers of inRNA degradation (8,15,19). To test
`whether a similar dependence is true for mammalian cells, we
`transfected PTEN siRNA molecules with 3' or 5' overhangs or
`without overhangs into HeLa cells. Surprisingly, we did not
`observe a more efficient knock-down of target RNA with
`siRNAs containing 3' overhangs when compared to blunt
`molecules or those with 5' overhangs (Fig. 2A). Similar results
`were obtained for the second target pi 1013 (Fig. 2C). To verify
`the observed inRNA knock-down, we performed an iminuno-
`blot analysis using PTEN-specific antibodies (Fig. 2B). In
`these experiments the reduction of PTEN protein expression
`as well as the downstream phosphoryiation of Aktl kinase, a
`consequence of PTEN protein inhibition (16,17), was very
`similar with the different siRNA duplexes. We concluded
`from these data that 3' overhangs on synthetic siRNAs arc not
`essential for RNAi in HeLa cells.
`
`Duplex length requirements Of siRNA duplexes in
`mammalian cells
`We next examined the effects of duplex length variations on
`siRNA activity. For these experiments we used the Aktl
`kinase as a target. Duplexes of 19 nt length were highly
`efficient in reducing Aktl mRNA levels independent of the
`nature (deoxyrihonucleotides or rihonucleotides) of the 3'
`overhang (Fig. 3A, compare molecules 1AB, 2AB, 3AB and
`4AB). This result is consistent with our observation that a 3'
`overhang appears not to be crucial for siRNA function in HeLa
`cells. Next we reduced the duplex length to 17 nt (Fig. 3A,
`molecule 5AB). This molecule did show a dramatically
`reduced silencing activity, suggesting that active siRNA
`duplexes must have a minimal length (-19 nt), which is in
`agreement with experiments assessing activity of siRNA
`molecules with different duplex lengths in Drosophila extracts
`(15). This minimal duplex length for active siRNA molecules
`might be explained mechanistically by two different require-
`ments. First, a minimal base pairing between the antisense
`siRNA and the target mRNA may be obligatory or, second,
`incorporation into the RISC requires a minimal length of the
`siRNA duplex. To address this question we synthesised and
`
`This material was copied
`at the NLM and may be
`Subject US Copyright Laws
`
`(cid:9)
`

`

`2708 Nucleic Acids Research, 2003, Vol. 31, No. 11
`
`A
`
`B (cid:9)
`
`C
`
`Ratio PTENip110a
`N.)
`c) v s (cid:9)
`N Zn
`
`o 25nM
`o 5nM
`o 1nM
`0.2nM
`
`PTEN1A (cid:9)
`PTEN1B (cid:9)
`
`PTEN1AK4 (cid:9)
`PTEN1SK1 (cid:9)
`
`cguuagcagaaac aaa aggag- TT
`5' (cid:9)
`3' TT-gcaaucgucuuugummccuc
`
`3
`
`V
`.! (cid:9)
`•
`CgugagcaCaaagaaaaugag -TT
`5' (cid:9)
`3' TT-gcacucguguuucuuuuacuc
`
`Cguuagcagaaacaaaaggag
`5" (cid:9)
`PTEN2A (cid:9)
`PTEN28 3' gcsaucgucuungummccuc
`
`PT EN2A114 (cid:9)
`PTEN2131-23 (cid:9)
`
`PTEN3A (cid:9)
`PTEN313 (cid:9)
`
`•
`3 VT (cid:9)
`agugagcacaaagaaaaugag
`gcacucgugULMCUuuuacuc
`
`5' TT-cguuagcagaaacaaaaggag
`gcaau cgu cutzugUmm C CU c- TT
`3' (cid:9)
`
`PTEN3A1111 (cid:9)
`PTEN3E2.41 (cid:9)
`
`•
`11,
`1'
`•
`5' TT-cgugagcacaaagaaaaugag
`gcacucgugUllucUUuuacuc-TT
`3' (cid:9)
`
`UT lAB 1A13 2AB 2AB 3AD 3AB GB GB
`MM (cid:9)
`MM
`MM (cid:9)
`MM (cid:9)
`
`pi 10“. — (cid:9)
`
`1"mi
`
``""., ••••.. (cid:9)
`
`••••••
`
`PTEN
`
`P*-Akt
`
`.•1=•=1•
`
`••••••.•
`
`1 2 3 4 5 6 7 8 9
`
`Ratio p11013/ pliOct
`o o o c>
`IV
`-a) (cid:9)
`-4).
`
`s)
`
`p110131A (cid:9)
`1)1.1.0pia (cid:9)
`
`uggaaugaaccacuggaauuu-TT
`5' (cid:9)
`3' TT-accuuacuuggugaccuuaaa
`
`TV! (cid:9)
`•
`ginolDisadm
`5' ugguaucaagaucaggaauau-TT
`pllOPTEM 3' TT-accauaguucgagucCUUalla
`
`p13.0132A (cid:9)
`p1101325 (cid:9)
`
`p110133A (cid:9)
`p110133B (cid:9)
`
`uggaaugaacCaCUggaauuu
`accuuacuuggugaccuuaaa
`
`3' (cid:9)
`
`5' TT-uggaaugaaccacuggaauuu
`nccuuacuuggugaccuuaaa-TT
`
`UT
`
`Figure 2. siRNA duplexes with a 3' or 5' overhang or without overhang (blunt) arc equally potent in mediating gene silencing in HeLa cells. (A) Inhibition
`of PTEN mRNA expression in HeLa cells transfected wills the indicated amounts of siRNA molecules. The sequences and different terminal structures of the
`siRNAs molecules are shown on the left. Mutations in the mismatch molecules are indicated by arrowheads. Samples were analysed in parallel for the level
`of PTEN mRNA expression 24 h after transfection by real time RT—PCR (Taqman) analysis. PTEN mRNA levels are shown relative to the mRNA levels of
`pl Ulla, which served as internal reference. Each bar represents triplicate transfections (± SD). (B) Inhibition of PTEN protein expression by use of siRNAs
`with different terminal structures. The cells were harvested 48 h after transfeetion of the indicated siRNAs (30 nM) (lanes 2-7) or GeneBlocs (30 nM) (lanes
`8 and 9). Cell extracts were separated by SDS—PAGE and analysed by immunoblotting using anti-010o., anti-PTEN or anti-phospho-Akt antibody. The
`amount of pl lOcx was used as a loading control and control cell extracts from untransfected HeLa cells (UT) were loaded in lane t. (C) Inhibition of pl
`mRNA expression in HeLa cells transfected with the indicated amounts of siRNA molecules. pl l03 mRNA levels are shown relative to the inRNA levels of
`pl Ma, which served as internal reference. The ratio of p11013/p110a inRNA of untransfected HeLa cells is shown at the bottom (UT). Each bar represents
`triplicate transfectinns (I- SD).
`
`transfected 19 nt long siRNA duplex molecules with one and
`two terminal mutations (CG and UA inversion) relative to the
`wild-type sequence (Fig. 3A, molecules 6AB and 7AB), Both
`
`molecules, even the molecule with a stretch of only 15 nt base
`pairing to the target mRNA, were functional in reducing the
`Aktl tnRNA level. We concluded from this result that the
`
`This material was copied
`at the HIJA and maybe
`su bject US Copyr ight Laws
`
`

`

`A
`
`Aktl 1A (cid:9)
`Aktl 18 (cid:9)
`
`cgaggggaguacaucaaga-uu
`5' (cid:9)
`3' uu-gcuecccucauguaguucu
`
`cgaggggaguacaucaaga-cc
`5' (cid:9)
`3" uu-gcuccccucauguaguucu
`
`cgaggggaguaoaucaaga-CC
`5' (cid:9)
`3' TT-gcuccccucauguaguucu
`
`cgaggggaguacaucaaga-TT
`5' (cid:9)
`3' TT-gcuceccucauguaguucu
`
`gaggggaguacaucaaq-ac
`5' (cid:9)
`3' ug-cuccocucauguaguuc
`•
`ggaggggaguacaucaagu-TT
`5' (cid:9)
`3" TT-ccuccccucauguaguuca
`Iry (cid:9)
`if
`geaggggaguacaucaaou-TT
`5" (cid:9)
`3' TT-cgucaccucauguaguuga
`
`Aktl 2A (cid:9)
`Aktl 28 (cid:9)
`
`Aktl 3A (cid:9)
`Aktl 38 (cid:9)
`
`Aktl 4A (cid:9)
`Akt1 48 (cid:9)
`
`Aktl SA (cid:9)
`Aktl 58 (cid:9)
`
`Aktl (cid:9)
`Aktl 68. (cid:9)
`
`Aktl 7A (cid:9)
`Aktl 73 (cid:9)
`
`PTEN lA (cid:9)
`PTEN 18 (cid:9)
`
`Nucleic Acids Research, 2003, Vol. 31, No. 11 2709
`
`Duplex length (cid:9)
`
`Ratio Aktl p1 lOcc
`
`is. C) Ca •-•
`
`19mer
`
`19mer
`
`19mer
`
`19mer
`
`17mer
`
`19nner(2MM)
`
`19nner(4MM)
`
`cguuagcagaaacaaaaggag -TT
`5" (cid:9)
`3" TT-gcaaucgucuuuguuuuccuc
`
`21mer
`
`Ratio PTEN/p1lOcc
`
`UT
`
`40nM
`o 20nM
`O 10nM
`▪ 5nM
`
`ATENA
`PTENB
`
`PTENMM1
`PTENMM1
`
`PTENMM2
`PTENMM2
`
`PTENMM3
`PTENHHIG
`
`PTEMMK4
`PTEMMK4
`
`5'guuagcagaaacaaaagga
`3'caaucgucuuuguuuuccu
`•
`5'guuagcagaaagaaaagga
`3 caaucgucuuucuuuuccu
`
`5 4 guuagcaaaa;aaaagga
`3"caaucguguuucuuuuccu
`
`3 V V
`5 .guuaccacaaagaaaagga
`3' caaugguguuuC