(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT)
`
`(19) World Intellectual Property
`Organization
`International Bureau
`
`(43) International Publication Date
`29 September 2005 (29.09.2005)
`
`
`
`(51) International Patent Classification:
`
`Not classified
`
`(21) International Application Nlmlber:
`PCT/US2005/008182
`
`(22) International Filing Date:
`
`11 March 2005 (11.03.2005)
`
`(25) Filing Language:
`
`(26) Publication Language:
`
`English
`
`English
`
`(74)
`
`(81)
`
`(30) Priority Data:
`60/552,620
`60/559,824
`60/647,191
`
`12 March 2004 (12.03.2004)
`5 April 2004 (05.04.2004)
`25 January 2005 (25.01.2005)
`
`US
`US
`US
`
`(71) Applicant (for all designated States except US): ALNY-
`LAl\I PHARMACEUTICALS, INC. [US/US]; 300 Third
`Street, Cambridge. MA 02142 (US).
`
`
`
`(10) International Publication Number
`
`WO 2005/089224 A2
`
`Street, Apartment #3, Brooklinc, MA 02446 (US).
`lVIANOI-IARAN,
`lVInthiah [US/US]; 25 Circle Dr,
`Weston, MA 02493 (US). RAJEEV, Kallanthottahil, G.
`[IN/US]; 30 Cambridgepark Drive, Apt. 4101, Cambridge,
`MA 02140 (US). HADWIGER, Pliillipp [AT/DE];
`Schlesierstr. 6, D—96264 Altenkunstadt (DE).
`
`Agents: LIYERS, Louis et a1; Fish & Richardson RC,
`225 Franklin Street, Boston, MA 02110-2804 (US).
`
`Designated States (unless otherwise indicated, for every
`kind of national protection available): AE, AG, AL, AM,
`AT, AU, AZ, BA, BB, BG, BR, BW, BY, BZ, CA, CH, CN,
`CO, CR, CU, CZ, DE, DK, DM, DZ, EC, EE, EG, ES, FI,
`GB, GD, GE, GH, GM, HR, HU, ID, IL, IN, IS, JP, KE,
`KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MA, MD,
`MG, MK, MN, MW, MX, MZ, NA, NI, NO, NZ, OM, PG,
`PH, PL, PT, RO, RU, SC, SD, SE, SG, SK, SL, SM, SY, TJ,
`TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, YU, ZA,
`ZM, ZW.
`
`(72) Inventors; and
`DE
`only):
`(for
`(75) Inventors/Applicants
`66
`[CA/US];
`Antonin
`FOUGEROLLES,
`(US).
`Brookline, MA 02446
`Summit Avenue,
`FRANK-KAMENETSKY, Maria [US/US]; 8 Fairbanks
`
`I/S
`
`(84)
`
`Designated States (unless otherwise indicated, fin" every
`kind of regional proteetion available): ARIPO (BW, GII,
`GM, KE, LS, MW, MZ, NA, SD, SL, SZ, TZ, UG, ZM,
`ZW), Eurasian (AM, AZ, BY, KG, KZ, MD, RU, TJ, TlVI),
`European (AT, BE, BG, CH, CY, CZ, DE, DK, EE, ES, Fl,
`
`[Continued on next page]
`
`(54) Title: iRNA AGENTS TARGETING VEGF
`
`
`
`
`
`2005/089224A2||||||||||||||||||||||||||||||||||||||||
`
`W0
`
`
`
`hVEGFexpression,Va
`
`
`
`+AL—DP-4OOZ
`
`—§0-AL-DP-4014
`
`-*-AL-DP-4DO,3
`
`--fl—AL-DP-401.5
`
`—-C-—-e'AL-DP-4004
`
`—0-AL-DP-4016
`
`- I- ~hVEGF Reich at at.
`
`- '- ImmVEJGF Filleur etal.
`
`10
`siRNA, {TM
`
`15
`
`293 I
`
`Lecooom-y
`
`(57) Abstract: The features of the present invention relate to compounds, compositions and methods useful for modulating the
`expression of vascular endothelial growth factor (VEGF), such as by the mechanism of RNA interference (RNAi). The compounds
`and compositions include iRNA agents that can be unmodified or chemicallyemodified.
`
`i
`
`Alnylam Exh. 1083
`
`Alnylam Exh. 1083
`
`

`

`WO 2005/089224 A2
`
`|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
`
`FR, GB, GR, HU, IE, IS, IT, LT, LU, MC, NL, PL, PT, RO,
`SE, SI, SK, TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN,
`GQ, GW, ML, MR, NE, SN, TD, TG).
`Declarations under Rule 4.17:
`
`IL, IN, IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU,
`LV, MA, MD, MG, MK, MN, MW, MX, MZ, NA, NI, NO, NZ,
`OM, PG, PH, PL, PT, R0, RU, SC, SD, SE, SG, SK, SL, SM,
`SY, TJ, TM, TN, TR, TT, TZ, UA, UG, UZ, VC, VN, YU, ZA,
`ZM, ZW, ARIPO patent (BW, GH, GM, KE, LS, MW, MZ,
`NA, SD, SL, SZ, TZ, UG, ZM, ZW), Eurasian patent (AM,
`AZ, BY, KG, KZ, MD, RU, I'J, TM), European patent (Al;
`BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR,
`HU, IE, IS, IT LT, LU, MC, NL, PL, PT, RO, SE, SI, SK.
`TR), OAPI patent (BE BJ, CE CG, CI, CM, GA, GN, GQ,
`GW, ML, MR, NE, SN, TD, TG)
`
`— as to applicant’s entitlement to apply for and be granted
`a patent (Rule 4,I7(ii)) for the following designations AE,
`AG, AL, AM, AT, AU, AZ, BA, BB, BG, BR, BW, BY, BZ,
`CA, CH, CN, CO, CR, CU, CZ, DE, DK, DM, DZ, EC, EE,
`EG, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL, IN, IS,
`JR KE, KG, KR KR, KZ, LC, LK, LR, LS, LT: LU, LV, M4.
`MD, MG, MK, MN, MW, MX, tVIZ, NA, N1, NO, NZ, OM,
`PG, PH, PL, PT, R0, RU, SC, SD, SE, SG, SK, SL, SM, SY,
`Published:
`TJ, TM, TN, TR, TT. TZ, UA, UG, UZ, VC, VN, YU, 24,
`ZM, ZW, ARIPO patent (BW, GH, GM, KE, LS, MW MZ, — without international search report and to be republished
`NA, SD, SL, sz, TZ, UG, ZM, ZW), Eurasian patent (AM,
`upon receipt Of that report
`AZ, BY. KG, KZ, MD, RU, TJ, TM), European patent (AT
`BE, BG, CH, CY. CZ. DE, DK, EE, ES, FI, FR, GB. GR,
`HU,. IE, 15, IT, LT. LU, MC, NL, PL, PT, R0, SE, SI, SK,
`TR), OAPI patent (BF, BJ, CF, CG, CI. CM, GA, GN, GQ,
`GW, ML, MR, NE, SN, TD, TG)
`— as to the applicant’s entitlement to claim the priority of the
`earlier application (Rule 4.1 7(iii)) for the following desig—
`nations AE, AG, AL, AM, AT, AU, AZ, BA, BB, BG, BR, BW,
`BY, BZ, CA, CH, CN, CO, CR, CU, CZ, DE, DK, DM, DZ,
`EC, EE, EG, ES, El, GB, GD, GE, GH, GM, HR, HU, ID,
`
`For two—letter codes and other abbreviations, refer to the "Guid-
`ance Notes on Codes andAbbreviations” appearing at the begin-
`ning of each regular issue of the PCT Gazette.
`
`ii
`
`

`

`WO 2005/089224
`
`PCT/US2005/008182
`
`iRNA AGENTS TARGETING VEGF
`
`RELATED APPLICATIONS
`
`This application claims the benefit of U.S. Provisional Application No. 60/552,620, filed
`
`March 12, 2004, U.S. Provisional Application No. 60/559,824, filed April 5, 2004, and U.S.
`
`Provisional Application No. 60/647,191, filed January 25, 2005. All three provisional
`
`applications are incorporated herein by reference in their entirety.
`
`FIELD OF THE INVENTION
`
`The present invention is in the filed of iRNA agents that can inhibit expression of vascular
`
`endothelial growth factor (VEGF). The invention also relates to the use of siRNA targeting
`
`VEGF sequences to treat conditions or disorders related to unwanted expression of VEGF, e. g.,
`
`age-related macular degeneration or diabetic retinopathy.
`
`BACKGROUND
`
`VEGF (also known as vascular permeability factor, VPF) is a multifunctional cytokine
`
`that stimulates angiogenesis, epithelial cell proliferation, and endothelial cell survival. VEGF
`
`can be produced by a wide variety of tissues, and its overexpression or aberrant expression can
`
`result in a variety disorders, including retinal disorders such as age-related macular degeneration
`
`and diabetic retinopathy, cancer, asthma, and other angiogenic disorders.
`
`Macular degeneration is a major cause of blindness in the United States and the
`
`frequency of this disorder increases with age. Macular degeneration refers to the group of
`
`diseases in which sight-sensing cells in the macular zone of the retina malfunction or loose
`
`function and which can result in debilitating loss of vital central or detail vision. Adult macular
`
`degeneration (AMD), which is the most common form of macular degeneration, occurs in two
`
`main forms. Ninety percent of people with AMD have the form described as “ ry” macular
`
`degeneration. An area of the retina is affected, which leads to slow breakdown of cells in the
`
`macula, and a gradual loss of central vision. The other form ofAMD is “wet” macular
`
`degeneration. Although only 10% of people with AMD have this type, it accounts for 90% of
`
`blindness from the disease. As dry AMD progresses, new blood vessels may begin to grow and
`
`10
`
`15
`
`20
`
`25
`
`30
`
`

`

`WO 2005/089224
`
`PCT/US2005/008182
`
`cause “wet” AMD. These new blood vessels often leak blood and fluid under the macula. This
`
`causes rapid damage to the macula that can lead to loss of central vision in a short time. iRNA
`
`agents targeting VEGF can be useful for the treatment of wet and dry macular degeneration.
`
`RNA interference or “RNAi” is a term initially coined by Fire and co-workers to describe
`
`the observation that double-stranded RNA (dsRNA) can block gene expression when it is
`
`introduced into worms (Fire at al., Nature 391:806-811, 1998). Short dsRNA directs gene-
`
`specific, post-transcriptional silencing in many organisms, including vertebrates, and has
`
`provided a new tool for studying gene function. RNAi has been suggested as a method of
`
`developing a new class of therapeutic agents. However, to date, these have remained mostly as
`
`suggestions with no demonstrate proof that RNAi can be used therapeutically.
`
`The present invention advances the art by providing a detailed gene walk across the
`
`VEGF gene and a detailed structural analysis of modifications that can be employed to stabilize
`
`the molecule against degradation and increase cellular uptake and targeting.
`
`SUMMARY OF THE INVENTION
`
`The invention provides compounds, compositions and methods useful for modulating the
`
`expression of VEGF. The invention provides compounds, compositions and methods useful for
`
`modulating the expression of VEGF activity by RNA interference (RNAi) using small nucleic
`
`acid molecules, such as short interfering RNA (siRNA), double—stranded RNA (dsRNA),
`
`microRNA (miRNA) and short hairpin RNA (shRNA) molecules, which collectively fall under
`
`the general term of iRNA agents. The iRNA agents can be unmodified or chemically—modified
`
`nucleic acid molecules. The iRNA agents can be chemically synthesized or expressed from a
`
`vector or enzymatically synthesized. The invention provides various chemically-modified
`
`synthetic iRNA agents capable of modulating VEGF gene expression or activity in cells and in a
`
`mammal by RNAi. The use of a chemically-modified iRNA agent can improve one or more
`
`properties of an iRNA agent through increased resistance to degradation, increased specificity to
`
`target moieties, improved cellular uptake, and the like.
`
`In one aspect, the invention provides an iRNA agent that down-regulates expression of a
`
`VEGF gene. The VEGF gene can include a VEGF encoding sequence and/or VEGF regulatory
`
`sequences such as may exist 5’ or 3 ’ of a VEGF open reading frame (ORF).
`
`10
`
`15
`
`20
`
`25
`
`30
`
`

`

`WO 2005/089224
`
`PCT/U82005/008182
`
`In one embodiment, the invention provides an isolated iRNA agent including a sense and
`
`antisense sequence, where the sense and antisense sequences can form an RNA duplex. The
`
`sense sequence can include a nucleotide sequence that is identical or substantially identical to a
`
`target sequence of about 19 to 23 nucleotides of a VEGF sequence. In one embodiment, the
`
`VEGF sequence that is targeted includes the sequence of any one of SEQ ID NOs:2—401 (see
`
`Table 1).
`
`'
`
`In one embodiment, the sense sequence of the iRNA agent includes a sequence identical
`
`or substantially identical to any of the VEGF target sequences, e.g., substantially identical to any
`
`of sense sequences provided in Table 1, SEQ ID NOs22—401. In another embodiment, the
`
`antisense sequence of the iRNA agent can include a sequence complementary to or substantially
`
`complementary to, any of the target sequences, e.g., complementary to any of SEQ ID NOs:2—
`
`401. By “substantially identical” is meant that the mismatch between the nucleotide sequences
`
`is less than 50%, 40%, 30%, 20%, 10%, 5%, or 1%. Preferably, no more than 1, 2, 3, 4, or 5
`
`nucleotides differ between the target sequence and sense sequence. Furthermore, sequences that
`
`are “complementary” to each other (e.g., sense and antisense sequences) can be fully
`
`complementary, or can have no more than 1, 2, 3, 4, or 5 nucleotides that lack full
`
`complementarity.
`
`In one embodiment, the sense and antisense pairs of sequences of an iRNA agent includes
`
`any one of the agents provided in Table 2, or a sequence which differs in the sense strand from
`
`the recited sequence by no more than 1, 2, 3, 4, or 5 nucleotides, or in the antisense strand by no
`
`more than 1, 2,3, 4, or 5 nucleotides, or in both strands by no more than 1, 2, 3, 4, or 5
`
`nucleotides.
`
`In one preferred embodiment, the sense sequence of an iRNA agent includes a sequence
`
`that is selected from the group consisting of SEQ ID NO:456, SEQ ID N02550, SEQ ID
`
`N01608, and SEQ ID NOz634, or a sequence that differs from the recited sequence by no more
`
`than 1, 2, 3, 4, or 5 nucleotides.
`
`In another embodiment, the antisense sequence of the iRNA agent includes a sequence
`
`fully complementary or substantially complementary to any of the VEGF target sequences,
`
`e.g., complementary or substantially complementary to any of SEQ ID NOs:2-401.
`
`10
`
`15
`
`20
`
`25
`
`

`

`WO 2005/089224
`
`PCT/U82005/008182
`
`In another embodiment, the antisense sequence of an iRNA agent includes a sequence
`
`selected from the group consisting any of the antisense sequences provided in Table 2, or a
`
`sequence which differs from the recited sequence by no more than 1, 2, 3, 4, or 5 nucleotides. In
`
`a preferred embodiment, this antisense sequence is fiilly complementary to a sense sequence or
`
`has no more than 1, 2, 3, 4, or 5 nucleotide mismatches with the sense sequence.
`
`In a preferred embodiment, the antisense sequence of an iRNA agent includes a sequence
`
`selected from the group consisting of SEQ ID NO:457, SEQ ID NO:551, SEQ ID N02609, and
`
`SEQ ID N01635, or a sequence that differs from the recited sequence by no more than 1, 2, 3, 4,
`
`or 5 nucleotides.
`
`10
`
`In another embodiment, the iRNA agent is chemically modified. For example, the iRNA
`
`agent can include a non-nucleotide moiety. A chemical modification or other non-nucleotide
`
`moiety can stabilize the sense and antisense sequences against nucleolytic degradation.
`
`Additionally, conjugates can be used to increase uptake and target uptake of the iRNA agent to
`
`particular cell types. Preferred modifications include those specifically provided in the
`
`15
`
`Examples, Tables 6-19.
`
`In another embodiment, the iRNA agent includes a 3’—overhang that ranges from 1 to
`
`about 6 nucleotides. As used herein, a “3’overhang” refers to at least one unpaired nucleotide
`
`extending from the 3’ end of an iRNA sequence. The 3’ overhang can include ribonucleotides or
`
`deoxyribonucleotides or modified ribonucleotides or modified deoxyribonucleotides. The 3’
`
`20
`
`overhang is preferably from 1 to about 5 nucleotides in length, more preferably from 1 to about 4
`
`nucleotides in length and most preferably from about 2 to about 4 nucleotides in length. The 3 ’
`
`overhang can occur on the sense or antisense sequence, or on both sequences of an iRNA agent.
`
`In one preferred embodiment, the iRNA agent of the invention includes an antisense
`
`sequence having 23 nucleotides complementary to the target VEGF sequence and a sense
`
`25
`
`sequence having at least 21 nucleotides. Each sequence can include at least 21 nucleotides that
`
`are complementary to each other, and at least the antisense sequence can have a 3 ’ overhang of
`
`two nucleotides.
`
`In one embodiment, both the sense and antisense sequences of the iRNA agent include a
`
`3’ overhang, the length of which can be the same or different for each sequence. In one
`
`30
`
`embodiment, the 3’ overhang on each sequence ranges from 1 to about 6 (e.g., from 1 to about 3)
`
`

`

`WO 2005/089224
`
`PCT/U82005/008182
`
`nucleotides in length. In a preferred embodiment, the 3’ overhang is on both sequences of the
`
`iRNA agent and is two nucleotides in length. In another preferred embodiment, the 3 ’ overhang
`
`is on both sequences of the iRNA agent and the 3 ’ overhangs include two thymidylic acid
`
`residues (“TT”).
`
`In one embodiment, an iRNA agent includes an antisense sequence having about 19 to 25
`
`(e.g., about 19, 20, 21, 22, 23, 24, or 25) nucleotides with complementarity to an RNA sequence
`
`encoding a VEGF protein. The iRNA agent can further include a sense sequence having about
`
`19 to 25 (e.g., about 19, 20, 21, 22, 23, 24, or 25) nucleotides, and the antisense and sense
`
`sequences can have distinct nucleotide sequences with at least about 19, 20, or 21
`
`10
`
`complementary nucleotides.
`
`15
`
`20
`
`25
`
`In one embodiment, an iRNA agent of the invention includes an antisense region having
`
`about 19 to about 25 (e.g., about 19 to about 23) nucleotides with complementarity to an RNA
`
`sequence encoding VEGF, and a sense region having about 19 to 25 (e.g., about 19 to about 23)
`
`nucleotides. The sense and antisense regions can be included in a linear molecule with at least
`
`about 19 complementary nucleotides. The sense sequence can include a nucleotide sequence that
`
`is substantially identical to a nucleotide sequence of VEGF.
`
`In one embodiment, the iRNA agent includes an antisense sequence of about 21
`
`nucleotides complementary to the VEGF target sequence and a sense sequence of about 21
`
`nucleotides complementary to the antisense sequence. The iRNA agent can include a non—
`
`nucleotide moiety. In one embodiment, the sense or antisense sequence of the iRNA agent can
`
`include a 2’-O-n1ethyl (2’—OMe) pyrimidine nucleotide, 2’-deoxy nucleotide (e.g., deoxy—
`
`cytodjne), 2’—deoxy—2’-fluoro (2’-F) pyrimidine nucleotide, 2’-O-methoxyethyl (2’-O-MOE), 2’—
`
`O—aminopropyl (2’-O-AP), 2’-O-N-methylacetamido (2'-O-NMA), 2’-O-
`
`dimethylaminoethlyoxyethyl (2'—DMAEOE), 2’-O-dimethylaminoethyl (2’-O-DMAOE), 2’-O-
`
`dimethylaminopropyl (2’—O-AP), 2'-hydroxy nucleotide, or a 2'—ara-fluoro nucleotide, or a locked
`
`nucleic acid (LNA), extended nucleic acid (ENA), hexose nucleic acid (HNA), cyclohexene
`
`nucleic acid (CeNA), ribo-difluorotoluyl, 5-allyamino-pyrimidines, or 5-Me-2’-modified
`
`pyrimidines. A 2’ modification is preferably a 2’-0Me modification, and more preferably, a 2’-
`
`fluoro modification. In a preferred embodiment, one or more 2’ modified nucleotides are on the
`
`30
`
`sense strand of the iRNA agent.
`
`

`

`WO 2005/089224
`
`PCT/U82005/008182
`
`In one embodiment, an iRNA agent includes a nucleobase modification, such as a cationic
`
`modification, such as a 3 ’—abasic cationic modification. The cationic modification can be, e.g.,
`
`an alkylamino—dT (e.g., a C6 amino—dT), an allylamino conjugate, a pyrrolidine conjugate, a
`
`pthalamido a hydroxyprolinol conjugate or an aminooxy conjugate, on one or more of the
`
`terminal nucleotides of the iRNA agent. An alkylamino-dT conjugate is preferably attached to
`
`the 3’ end of the sense or antisense strand of an iRNA agent. A pyrrolidine linker is preferably
`
`attached to the 3 ’ or 5 ’ end of the sense strand, or the 3’ end of the antisense strand. An ally]
`
`amine uridine is preferably on the 3’ or 5’ end of the sense strand, and not on the 5’ end of the
`
`antisense strand. An aminooxy conjugate can be attached to a hydroxyl prolinol and at the 3 ’ or
`
`10
`
`5’ end of either the sense or antisense strands.
`
`In another embodiment, an iRNA agent that targets VEGF includes a conjugate, e.g., to
`
`facilitate entry into a cell or to inhibit exo— or endonucleolytic cleavage. The conjugate can be,
`
`for example, a lipophile, a terpene, a protein binding agent, a Vitamin, a carbohydrate, a retinoid
`
`or a peptide. For example, the conjugate can be naproxen, nitroindole (or another conjugate that
`
`contributes to stacking interactions), folate, ibuprofen, retinol or a C5 pyrimidine linker. In other
`
`embodiments, the conjugates are glyceride lipid conjugates (ag. a dialkyl glyceride derivatives),
`
`vitamin E conjugates, or thio-cholesterols. Preferably, conjugates are on the 3’ end of the
`
`antisense strand, or on the 5’ or 3’ end of the sense strand, and preferably the conjugates are not
`
`on the 3 ’ end of the antisense strand and on the 3’ end of the sense strand.
`
`In one embodiment, the conjugate is naproxen, and the conjugate is preferably on the 5’
`
`or 3’ end of the sense or antisense strands. In one embodiment, the conjugate is cholesterol or
`
`thiocholesterol, and the conjugate is preferably on the 5’ or 3 ’ end of the sense strand and
`
`preferably not present on the antisense strand. In some embodiments, the cholesterol is
`
`conjugated to the iRNA agent by a pyrrolidine linker, or serinol linker, or hydroxyprolinol linker.
`
`In another embodiment, the conjugate is cholanic acid, and the cholanic acid is attached to the 5’
`
`or 3’ end of the sense strand, or the 3’ end of the antisense strand.
`
`In one embodiment, the
`
`cholanic acid is attached to the 3’ end of the sense strand and the 3 ’ end of the antisense strand.
`
`15
`
`20
`
`25
`
`In another embodiment, the conjugate is retinol acid, and the retinol acid is attached to the 5’ or
`
`3’ end of the sense strand, or the 3’ end of the antisense strand. In one embodiment, the retinol
`
`30
`
`acid is attached to the 3’ end of the sense strand and the 3 ’ end of the antisense strand.
`
`

`

`WO 2005/089224
`
`PCT/U82005/008182
`
`In one aspect, an iRNA agent of the invention has RNAi activity that modulates
`
`expression of RNA encoded by a VEGF gene. VEGF genes can share some degree of sequence
`
`identity with each other, and thus, iRNA agents can target a class of VEGF genes, or
`
`alternatively, specific VEGF genes, by targeting sequences that are either shared amongst
`
`different VEGF targets or that are unique for a specific VEGF target. Therefore, in one
`
`embodiment, an iRNA agent can target a conserved region of a VEGF nucleotide sequence (e.g.,
`
`RNA sequence). The conserved region can have sequence identity with several different VEGF—
`
`related sequences (e.g., different VEGF isoforms, splice variants, mutant genes, eta). Thus, one
`
`iRNA agent can target several different VEGF—related sequences.
`
`In one embodiment, an iRNA agent is chemically modified. In another embodiment the
`
`iRNA agent includes a duplex molecule wherein one or more sequences of the duplex molecule
`
`is chemically modified. Non—limiting examples of such chemical modifications include
`
`phosphorothioate internucleotide linkages, 2’-deoxyribonucleotides, 2’-O-methyl
`
`ribonucleotides, 2’-deoxy—2’-fluoro ribonucleotides, “universal base” nucleotides, “acyclic”
`
`nucleotides, 5 ’—C-methyl nucleotides, and terminal glyceryl and/or inverted deoxy abasic residue
`
`incorporation. These chemical modifications, when used in iRNA agents, can help to preserve
`
`RNAi activity of the agents in cells and can increase the serum stability of the iRNA agents.
`
`In one embodiment, an iRNA agent includes one or more chemical modifications and the
`
`sense and antisense sequences of the double—stranded RNA is about 21 nucleotides long.
`
`In a preferred embodiment, the first and preferably the first two internucleotide linkages
`
`at the 5 ’ end of the antisense and/or sense sequences are modified, preferably by a
`
`phosphorothioate. In a preferred embodiment, the first, and preferably the first two, three, or
`
`four internucleotide linkages at the 3 ’ end of a sense and/or antisense sequence are modified,
`
`preferably by a phosphorothioate. More preferably, the 5’ end of both the sense and antisense
`
`sequences, and the 3’ end of both the sense and antisense sequences are modified as described.
`
`In another aspect, an iRNA agent that mediates the down-regulation of VEGF expression
`
`includes one or more chemical modifications that modulate the binding affinity between the
`
`sense and the antisense sequences of the iRNA construct.
`
`In one embodiment, the invention features an iRNA agent that includes one or more
`
`chemical modifications that can modulate the cellular uptake of the iRNA agent.
`
`10
`
`15
`
`20
`
`25
`
`30
`
`

`

`WO 2005/089224
`
`PCT/U82005/008182
`
`In another embodiment, the invention features an iRNA agent that includes one or more
`
`chemical modifications that improve the pharrnacokinetics of the iRNA agent. Such chemical
`
`modifications include but are not limited to conjugates, such as ligands for cellular receptors,
`
`e.g., peptides derived from naturally occurring protein ligands; protein localization sequences;
`
`antibodies; nucleic acid aptamers; vitamins and other co—factors, such as folate, retinoids and N-
`
`acetylgalactosamine; polymers, such as polyethyleneglycol (PEG, 6.g. PEG 5 and PEGZO);
`
`phospholipids; polyamines, such as spennine or spermidine; and others.
`
`In one embodiment, the iRNA agent includes a duplex molecule selected from the group
`
`consisting of AL—DP—4003, AL—DP—41 16, AL-DP-4015, AL-DP—4120, AL—DP—4002, AL-DP—
`
`4115, AL-DP—4014, AL—DP—41 19, AL—DP-4094, AL—DP-4118, AL-DP-4107, AL-DP-4122, AL-
`
`DP—4004, AL—DP—4 1 17, AL—DP-4016, AL-DP-4121, AL—DP-4127, AL-DP-4128, AL—DP-4129 ,
`
`and AL—DP—4055 (see Tables 2 and 3).
`
`In one preferred embodiment, the iRNA agent includes a duplex described as AL-DP-
`
`4094, Which includes the antisense sequence S’AAGCUCAUCUCUCCUAUGUGCUG 3’ (SEQ
`
`ID NO:609) and the sense sequence 5’ GCACAUAGGAGAGAUGAGCUU 3’ (SEQ ID
`
`10
`
`15
`
`NO:608).
`
`In another preferred embodiment, the iRNA agent includes a duplex described as AL—DP-
`
`4004, which includes the antisense sequence 5 ’CUUUCUUUGGUCUGCAUUCACAU 3 ’ (SEQ
`
`ID NO:63 5) and the sense sequence 5’ GUGAAUGCAGACCAAAGAAAG 3 ’ (SEQ ID
`
`20
`
`NO:634).
`
`In another preferred embodiment, the iRNA agent includes a duplex described as AL—DP-
`
`4015, which includes the antisense sequence 5’ GUACUCCUGGAAGAUGUCCTT 3 ’ (SEQ ID
`
`NO:551) and the sense sequence 5’ GGACAUCUUCCAGGAGUACTT 3’ (SEQ ID N02550).
`
`In another preferred embodiment, the iRNA agent includes a duplex described as AL—DP-
`
`4055, which includes the antisense sequence 5’ UGCAGCCUGGGACCACUUGTT 3’ (SEQ ID
`
`NO:457) and the sense sequence 5’ CAAGUGG-UCCCAGGCUGCATT 3’ (SEQ ID NO:456).
`
`In one embodiment, the antisense sequence of an iRNA agent described herein does not
`
`hybridize to an off-target sequence. For example, the antisense sequence can have less than 5, 4,
`
`3, 2, or 1 nucleotides complementary to an off-target sequence. By “off—target” is meant a
`
`sequence other than a VEGF nucleotide sequence.
`
`25
`
`30
`
`

`

`WO 2005/089224
`
`PCT/U82005/008182
`
`In another embodiment, the sense strand is modified to inhibit off-target silencing. The
`
`sense strand can include a cholesterol moeity, such as cholesterol attached to the sense strand by
`
`a pyrrolidine linker.
`
`In another embodiment, the antisense sequence of an iRNA agent described herein can
`
`hybridize to a VEGF sequence in a human and a VEGF sequence in a non-human mammal, e.g.,
`
`a mouse, rat, or monkey.
`
`In another aspect, the invention provides a method of delivering an iRNA agent, e.g., an
`
`iRNA agent described herein, to the eye of a subject, e.g., a mammalian subject, such as a mouse,
`
`a rat, a monkey or a human.
`
`In another aspect, the invention provides a method of delivering an iRNA agent to the eye
`
`of a subject, e.g., a mammalian subject, such as a mouse, a rat, a monkey or a human.
`
`In one embodiment, the iRNA agent can be delivered to a cell or cells in a choroid region
`
`of the eye. In one preferred embodiment, the iRNA agent down-regulates expression of the
`
`VEGF gene at a target site within the eye. An iRNA agent delivered to the eye, e. g., choroid
`
`cells of the eye, can be an unmodified iRNA agent.
`
`In one embodiment, the iRNA agent can be stabilized with phosphorothioate linkages. In
`
`another embodiment, the 3’ end of the sense or antisense sequences, or both, of the iRNA agent
`
`can be modified With a cationic group, such as a 3’-abasic cationic modification. The cationic
`
`modification can be, e. g., an alkylamino-dT (2.3., a C6 amino—dT), an allylamine, a pyrrolidine, a
`
`pthalamido, a hydroxyprolinol, a polyamine, a cationic peptide, or a cationic amino acid on one
`
`or more of the terminal nucleotides of the iRNA agent. The modification can be an external or
`
`terminal cationic residue. In preferred embodiments, a pyrrolidine cap is attached to the 3 ’ or 5 ’
`
`end of the sense strand, or the 3’ end of the antisense strand.
`
`In one embodiment, the sense or antisense sequence, or both, of the iRNA agent can be
`
`modified with a sugar, e. g., a glycoconjugate or alkylglycoside component, e.g., glucose,
`
`mannose, 2-deoxy-glucose, or an analog thereof. In another embodiment, the iRNA agent can be
`
`conjugated to an enzyme substrate, e.g., a substrate for which the relative enzyme is present in a
`
`higher amount, as compared to the enzyme level in other tissues of the body, e.g., in tissues other
`
`than the eye.
`
`10
`
`15
`
`20
`
`25
`
`

`

`WO 2005/089224
`
`PCT/U82005/008182
`
`In one embodiment, at least about 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the
`
`iRNA agent administered to the subject reaches the eye. In a preferred embodiment, between
`
`about 30—90%, 40-80% or 50-70% of the iRNA agent administered to the subject reaches the eye.
`
`In another aspect, the invention features a composition, e.g., a pharmaceutical
`
`composition that includes an iRNA agent of the present invention in a pharmaceutically
`
`acceptable carrier or diluent. The iRNA agent can be any agent described herein. In one
`
`embodiment, the iRNA agent is chemically modified, such as with any chemical modification
`
`described herein. Preferred modified iRNA agents includes those provided in Tables 2-19.
`
`In another aspect, the invention features a method for treating or preventing a disease or
`
`condition in a subject. The method can include administering to the subject a composition of the
`
`invention under conditions suitable for the treatment or prevention of the disease or condition in
`
`the subject, alone or in conjunction with one or more other therapeutic compounds.
`
`In one embodiment, the iRNA agent is administered at or near the site of unwanted VEGF
`
`expression, e. g., by a catheter or other placement device (e.g., a retinal pellet or an implant
`
`including a porous, non-porous, or gelatinous material). In one embodiment the iRNA agent is
`
`administered via an intraocular implant, which can be inserted, for example, into an anterior or
`
`posterior chamber of the eye; or into the sclera, transchoroidal space, or an avascularized region
`
`exterior to the vitreous. In another embodiment, the implant is positioned over an avascular
`
`region, such as on the sclera, so as to allow for transcleral diffusion of the drug to the desired site
`
`of treatment, e.g., to the intraocular space and macula of the eye. Furthermore, the site of
`
`transcleral diffusion is preferably in proximity to the macula.
`
`In another embodiment, an iRNA agent is administered to the eye by injection, e.g., by
`
`intraocular, retinal, or subretinal injection.
`
`In another embodiment, an iRNA agent is administered topically to the eye, such as by a
`
`patch or liquid eye drops, or by iontophoresis. Ointments or droppable liquids can be delivered
`
`by ocular delivery systems known in the art such as applicators or eye droppers.
`
`In one embodiment, an iRNA is delivered at or near a site of neovascularization.
`
`In one embodiment, an iRNA agent is administered repeatedly. Administration of an
`
`iRNA agent can be carried out over a range of time periods. It can be administered hourly, daily,
`
`once every few days, weekly, or monthly. The timing of administration can vary from patient to
`
`10
`
`15
`
`20
`
`25
`
`30
`
`10
`
`

`

`WO 2005/089224
`
`PCT/U82005/008182
`
`patient, depending upon such factors as the severity of a patient’s symptoms. For example, an
`
`effective dose of an iRNA agent can be administered to a patient once a month for an indefinite
`
`period of time, or until the patient no longer requires therapy. In addition, sustained release
`
`compositions containing an iRNA agent can be used to maintain a relatively constant dosage in
`
`the area of the target VEGF nucleotide sequences.
`
`In another embodiment, an iRNA agent is delivered to the eye at a dosage on the order of
`
`about 0.00001 mg to about 3 mg per eye, or preferrably about 0.0001-0.001 mg per eye, about
`
`0.03— 3.0 mg per eye, about 0.1—3.0 mg per eye or about 0.3—3.0 mg per eye.
`
`In another embodiment, an iRNA agent is administered prophylactically such as to
`
`prevent or slow the onset of a disorder or condition that affects the eye. For example, an iRNA
`
`can be administered to a patient Who is susceptible to or otherwise at risk for a neovascular
`
`disorder.
`
`In one embodiment one eye of a human is treated with an iRNA agent described herein,
`
`and in another embodiment, both eyes of a human are treated.
`
`In another aspect, a method of inhibiting VEGF expression is provided. One such method
`
`includes administering an effective amount of an iRNA agent of the present invention.
`
`In another aspect, a method of treating adult onset macular degeneration is provided. The
`
`method includes administering a therapeutically effective amount of an iRNA agent of the
`
`present invention.
`
`In one embodiment, a human has been diagnosed with dry adult macular degeneration
`
`(AMD), and in another embodiment the human has been diagnosed with wet AMD.
`
`In one embodiment, a human treated with an iRNA agent described herein is over the age
`
`of 50, e.g., between the ages of 75 and 80, and the human has been diagnosed with adult onset
`
`macular degeneration. In another embodiment, a human treated with an iRNA agent described
`
`herein is between the ages of 30-50, and the human has been diagnosed with late onset macular
`
`degeneration. In another embodiment, a human treated with an iRNA agent described herein