throbber
National Ce nter for Biotechn clog}.r Information
`
`M) U.S. National Library of Medicine
`
`
`
`BLAST E » blastn suite » results for RID-4EBWY3C4014 Home Recent Results Saved Strategies Help
`
`< Edit Search
`
`Save Search
`
`Search Summary V
`
`9 How to read this report? B BLAST Help Videos
`
`{Back to Traditional Results Page
`
`
`Filter Results
`
`Job Tl‘tle
`
`gb|MM914670.1|
`RID
`
`W
`Search expires on 02—16 06:39 am
`Download All v
`
`Program
`
`
`
`
`
`
`
`BLASTN 9 m v
`Database
`m
`paint
`See detailsv
`Query ID —
`MM9146?0_1
`
`
`
`to
`
`
`
`
`
`
`
`
`
`
`
`to
`
`
`
`lo
`
`
`
`
`
`
`Organism only top 20 will appear
`D exclude
`
`Type common name, binomial, taxid or group name
`
`
`+ Mganism
`
`
`
`
`Percent Identity E value
`Query Coverage
`
`Description
`
`Sequence 64 from patent US 10301638
`
`Molecule type
`
`nucleic acid
`
`Query Length
`
`903
`
`Other reports
`
`Distance tree of results MSA viewer 9
`
`Descriptions
`
`Graphic Summary
`Alignments
`Taxonomy
`
`
`'Alighrnenl'view I Pairwise
`V
`[—I EDS feature 0
`
`
`Dowhlfiad "
`
`
`
`A Download v
`GenBank Graphics
`
`«Descriptions
`
`1' Next
`
`Sequence 197 from patent US 9458436
`Sequence lD: KH273636.1 Length: 903 Number of Matches: 1
`
`Range 1: 1 to 903 GenBank flflhics
`Score
`Expect
`dentities
`Ga ps
`Strand
`1668 bit5(903}
`[3.0
`933K903(100%)
`9/903I[D%}
`PlusfPlus
`
`Query
`
`Sbjct
`
`1
`
`1
`
`Query
`
`61
`
`sh j ct El
`
`Query
`
`Sbjct
`
`Query
`
`121
`
`121
`
`181
`
`RTGTCTGCT‘I‘ CTGGAGCTTTGTTGCCTGC'I‘ATTGCT‘I'TCGCTGCT-TACGCTTACGCTAC
`||||||l|l||||||
`|llll|||||||||lll|||||||||||ll|||||||||lH
`ATGTCTGCTTCTGGAGCTTTGTTGCCTGCTATTGCTTTCGCTGCTTACGCTTACGCTAS
`
`TACGCTTATGCTTTCGAGTGGTCTCATGCTRACGGAATCGATRACGTGGATGCTAGAGR
`||||||lll||||||
`IJill|||||||||liJIIIIIIIIIIIHIIIIIIIIIIH
`TACGC‘T'I‘ATGC‘I‘TTCGAGTGGTCTCATGC TAACGGAATCGATAACGTGGATGC TAGAGe
`
`TGGATTGGAGCTTTGTCTTTGAGACTCCCTGCAATTGCTACCACCATGTACCTCTTGTT
`||||||l|1||||||
`|llll|||||||||111|||||||||||11|||||||||ll1
`TGGATTGGAGCTTTG”CTTTGAGACTCCCTGCAATTGCTACCACCATGTACCTCTTGTT
`
`TGCCTTGTGGGACCTAGATTGATGGCTAEGAGGGAGGCTTTTGATCCTAAGGGATTCAE
`||||||l1|||||||
`Ililll||||||||111||||||||||1|1|||||||||lH
`
`
`
`
`
`1 of 3
`1 of 3
`
`CSIRO Exhibit 1012
`CSIRO Exhibit 1012
`
`

`

`0 I.
`
`._I 00 I_.
`
`J
`TGCCTTGTGGGACCTAG TTTATSGCTAAGAGGGAGGCTTTTGATCCTAAGGGATTCAE
`
`Query
`
`Sbjc:
`
`Query
`
`241
`
`241
`
`301
`
`sbje:
`
`30
`
`CTCGCTTACAACGCTTACCAAACCGCTTTCAACGTTGTGGTGCTCGGAATGTTCGCTAE
`|
`|
`I
`|
`I
`III
`|
`|
`I
`|
`|
`II
`I
`|
`I
`III
`CTCGC TACAACGCTTACCAAACCGCTTTCAACG TGTGGTGCTCGGAATGTTCGCTAE
`
`GAGQTCTCTGGATTGGGACAACCTGTTTGGGGATCTACTATGCCTTGGAGCGATAGGA:
`|
`|
`I" |
`|
`'iII
`|
`| I,'|
`|
`Ii'I
`|
`I
`III
`GA 3TCTCTssennGGGACAACCHGHHHGGG"1T0"ACHAHGCCTTGGAGCGATAG".2
`
`361
`
`361
`
`TCC"TCAAGRT”""G"”GGGAG"GTGGC"CCATTACAACAA”AR”"ACCTCGAG"”GTT
`|
`|
`I
`|
`I
`III
`|
`|
`I'
`|
`|
`II
`I
`|
`I
`III
`Tcc”TCAACAT"n”GHHGGGAGfiGTGGCHCCATTACAACAAHAAGTACCTCGAGHHGTE
`
`421 Ghfifl ”GTG"TCA"GGr
`|.
`" |
`|
`
`Query
`
`353::
`
`Query
`
`Sbjc:
`
`Sbjc:
`
`Query
`
`Sbjc:
`Query
`
`353::
`
`Query
`
`Sbjct
`
`Query
`
`421 GA“; "GTG"TCA"GG’ Query
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`481
`
`481
`
`541
`
`541
`601
`
`601
`
`661
`
`661
`
`721
`
`c a
`C
`_
`GGG
`CAHCAhGCTHTsnnssr
`III
`I
`I
`III
`|
`|
`I
`|
`I
`CAHCAFGCT"TG""GA”"1GGGC"TGG"GGCTTGT""G”CA”CTCATGGC”ACCAACGE
`
`TGCRTCGATGC”"AT””CTGAGC"GC”"GCAA”TC”“"CA”CCACATCGTG r10":crrc
`|
`|
`I" |
`I
`'III
`|
`I I.'|
`|
`|i" |
`I
`III
`TG ATCGATGC”"AT””CTGAGC”GC”"GCAA”TC”“"Ch”CCACA1CGTG ”GHSCTC
`TAC"ACCTCATG"CTGC"1TGGGLR””AGA”GCCC"“GGAA AGATA"ATCACCCAG3C
`|
`|
`I
`|
`I
`III
`|
`|
`I'
`|
`|
`||
`|
`I
`III
`TAC”ACCTCATG"CTGC"1TGGGEAHHAGAHGCCC““GGAAGAGATA"ATCACCCAGGC
`
`ChasmGTTGCAAHHCGHGA_CG“GTHCGCTCAT10”GHHTHCGTGCTCAGACAAA:Gee
`|
`|
`I" |
`I
`III
`|
`I I.|
`I
`II
`I
`|
`I
`III
`CA amGTTG”AATTCGTGAICGTGTTCGCTCATsCTGTTTTCGTGCTCAGACAAAAGCR
`
`TGCCCTGTTACTTTGCCTTGSGC CAAATGTTCGTGATGACAAATAEGTTGGTGCTCTE
`|
`|
`I
`|
`I
`III
`|
`|
`I
`|
`|
`II
`I
`|
`I
`III
`TGCCCTGTTACTTTGCCTTGGGC CAAATGTTS"TGATGAcsgameTGTTGGTGCTCTE
`
`GGAAACTTCTACCTCAAGTCTTACTCTAACA£”TCTAGGGGAG"TGGAGCTTCTTCTGE
`|
`|
`I
`|
`I
`III
`I
`|
`'
`|
`I
`II
`I
`|
`I
`III
`GGAAACTTCTACCTCAAGSCTIACTCTAA AASICTAGGGGAG“TSGAGCTTCTT IGI
`
`AAGCCTGCTGAGACT"CTAGAGCACCTTCTGTSAGAEGAAC AGGTCC GGAAGATCGP
`
`SDth 721
`
`Query
`
`sbjct
`
`Query
`
`T81
`
`”81
`
`341
`
`SDth 341
`Query
`901
`
`AAGCéTéCTGAGAC1ACTAQA$CAQCTTC1G$GAQAAGAACCAQQT$CAQGAAQATQQ;
`TGA
`903
`
`Sbjct
`
`901
`
`101
`
`903
`
`
`
`.1. Download v
`GenBank Graphics
`
`It Previous «a Descriptich
`
`Sequence 197 from Patent W02005083093
`Sequence ID: 05161011] Length: 903 Number of Matches: 1
`
`See 10 more tille{s) V
`
`Related Information
`
`RENEE 1: 1 TO 903 _GenBanl( mm
`
`
`Strand
`Gaps
`centi ties
`Expect
`PIusfPILs
`0190x044)
`gas/903000010}
`0.0
`ATGTCTGCTTCTGGAGCTTTGTTGCCTGCTfTTGCTTTCGCTGCT;ACGCTTACGCTA£
`
`%_ aSSOCiatEd gene
`datai's
`
`ATGTQTQCTTQTGGAGCT1QQQTGQCTGC1A$TGQTTTCQCTGQQTACGQTTAQGCQAA
`TACGCTTATGCTTTCGAGTGGTCTCATGCTRACGGAATCGAEAACGTGGATGCTAGAGR
`I
`.
`.
`.
`.
`I
`I
`I
`.
`.
`.
`I
`.
`I
`I
`1ACG$”QATG;”"”éGAGTQQQC”QAHGC1AééqéAE"CéA”A$éGQGGAHGC1AGAé$
`
`CHCGC”TACAACGCT”ACCAAACCSC”"”CRACGT"G"GG”GCTCGGAATG””CGCTAE
`éTCGé $ACA£C6C1TACCAAACCéCTTTQAACG1TGTGQTGC1éGéAfi1GTTéGC$Aé
`GAGATCTCTGGATTGGGACAACCTGTTTGGGGATCTACTATGCCTTGGAGCGATAGGA}
`|
`|
`I" |
`|
`'iII
`|
`| I'I
`|
`|i'I
`|
`|
`iII
`GAGETCTCTGGATTGGGACAACCTGTTTGGGGETCTACTATGCCTTGGAGCGATAGGA}
`
`Score
`1668 bits(903)
`Query
`1
`
`Sbjct
`Query
`
`Sbjc:
`
`Query
`Sbjcz
`Query
`
`Sbjc:
`
`
`
`Query
`SDjC:
`Query
`
`Sbjc:
`
`1
`61
`
`61
`
`121
`121
`181
`
`181
`
`241
`241
`301
`
`301
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`TG A ”GGAGC”"”G”C"1TGAGAC”CCCTGC;ET"GC”AC ACCérG”ACC”C””GTT
`1GGA1”;“ZG$”"”Q”C"1QQAGAQHCCC1GéAA1“GC"ACCAééfléG”;CC”é””é$é
`TGCCTH1TGGGACCTAG"TTG£"GGC”AAG"GGGASGC"T””G"TCC"AAGGGAW”CAE
`I
`.
`.
`I
`I
`I
`.
`.
`.
`I
`.
`I
`I
`1GCC1HQTGGQACC1AG"Téé£"GéC”A§é"Tc?£GGC"1””G110¢"AAGGGAWHQAE
`
`2 of 3
`2 of 3
`
`CSIRO Exhibit 1012
`CSIRO Exhibit 1012
`
`

`

`
`
`GGCTCCI—L'I 'I" Cmck’éTéfi-E'IACCI‘CGAGTTG'I':
`|
`'
`|
`|
`|
`'
`|
`|
`GGCTC _"'—'__'IRCMCAEATii'C-“CACCI‘CGAGTTC—E'E
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`“C“
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`a |
`
`
`
`
`
`
`
`GARE-CUTS" CCF‘CEA GC'I'IECTC”
`|
`|
`accmcgeG-SCCC-ACTCT
`
`
`
`
`
`
`
`
`903
`SHE
`
`CG:
`
`TGA
`|
`TGA
`
`Que r3?
`SS" "1:.
`
`Query
`
`3 E
`3 E
`
`42
`
`Qaer'
`
`63
`
`
`
`63-
`
`SE-
`
`6E-
`
`72
`
`"2
`
`73
`
`T 3
`
`34
`
`34
`
`93
`BC
`
`Sz'ct
`
`Query
`
`Sbjot
`
`Quer'
`
`Shae
`
`Query
`
`s}: 4 :t
`
`Query
`
`sbjct
`
`Query
`Sb43t
`
`o 0 0 ® 0 ofilog
`
`OSupportCenter
`
`National Center for
`
`Popular
`
`Resources
`
`Actions
`
`BioteChnO|Ogy
`_
`I nfO rmatI 0' n
`
`8600 Rockville Pike
`Bethesda MD, 20894 USA
`
`About us Contact us Polioes
`
`FOIA
`
`Literature
`Health
`Genomes
`
`Genes
`Proteins
`
`Submit
`Download
`Learn
`
`Develop
`Analyze
`
`Chemicals
`
`Research
`
`PubMed
`PubMed Central
`Booksheif
`
`PubChem
`Gene
`
`BLAST
`Nucleotide
`
`Protein
`
`GEO
`
`NLM | NIH | HHS | USA.gov
`
`[ElFeedback
`
`3 of 3
`3of3
`
`CSIRO Exhibit 1012
`CSIRO Exhibit 1012
`
`

This document is available on Docket Alarm but you must sign up to view it.


Or .

Accessing this document will incur an additional charge of $.

After purchase, you can access this document again without charge.

Accept $ Charge
throbber

Still Working On It

This document is taking longer than usual to download. This can happen if we need to contact the court directly to obtain the document and their servers are running slowly.

Give it another minute or two to complete, and then try the refresh button.

throbber

A few More Minutes ... Still Working

It can take up to 5 minutes for us to download a document if the court servers are running slowly.

Thank you for your continued patience.

This document could not be displayed.

We could not find this document within its docket. Please go back to the docket page and check the link. If that does not work, go back to the docket and refresh it to pull the newest information.

Your account does not support viewing this document.

You need a Paid Account to view this document. Click here to change your account type.

Your account does not support viewing this document.

Set your membership status to view this document.

With a Docket Alarm membership, you'll get a whole lot more, including:

  • Up-to-date information for this case.
  • Email alerts whenever there is an update.
  • Full text search for other cases.
  • Get email alerts whenever a new case matches your search.

Become a Member

One Moment Please

The filing “” is large (MB) and is being downloaded.

Please refresh this page in a few minutes to see if the filing has been downloaded. The filing will also be emailed to you when the download completes.

Your document is on its way!

If you do not receive the document in five minutes, contact support at support@docketalarm.com.

Sealed Document

We are unable to display this document, it may be under a court ordered seal.

If you have proper credentials to access the file, you may proceed directly to the court's system using your government issued username and password.


Access Government Site

We are redirecting you
to a mobile optimized page.





Document Unreadable or Corrupt

Refresh this Document
Go to the Docket

We are unable to display this document.

Refresh this Document
Go to the Docket