RESEARCH ARTICLE
`
`Hepatoprotective Effect and Synergism of
`Bisdemethoycurcumin against MCD Diet-
`Induced Nonalcoholic Fatty Liver Disease in
`Mice
`Sung-Bae Kim1☯, Ok-Hwa Kang1☯, Young-Seob Lee2, Sin-Hee Han3, Young-Sup Ahn3,
`Seon-Woo Cha3, Yun-Soo Seo1, Ryong Kong2, Dong-Yeul Kwon1*
`
`1 Department of Oriental Pharmacy, College of Pharmacy, Wonkwang University, Wonkwang Oriental
`Medicines Research Institute, Iksan, Jeonbuk, 570–749, Korea, 2 BK21 Plus Team, Professional Graduate
`School of Oriental Medicine, Wonkwang University, Iksan, Jeonbuk, 570–749, Korea, 3 Department of
`Herbal Crop Research, National Institute of Horticultural & Herbal Science, RDA, 92 Bisanro, Eumsung,
`Chungbuk, 369–873, Korea
`
`☯ These authors contributed equally to this work.
`* sssimi@wku.ac.kr
`
`Abstract
`
`Nonalcoholic fatty liver disease (NAFLD), the hepatic manifestation of the metabolic syn-
`drome, has become one of the most common causes of chronic liver disease over the last
`decade in developed countries. NAFLD includes a spectrum of pathological hepatic
`changes, such as steatosis, steatohepatitis, advanced fibrosis, and cirrhosis. Bisde-
`methoxycurcumin (BDMC) is polyphenolic compounds with a diarylheptanoid skeleton,
`curcumin close analogues, which is derived from the Curcumae Longae Rhizoma. While
`the rich bioavailability research of curcumin, BDMC is the poor studies. We investigated
`whether BDMC has the hepatoprotective effect and combinatory preventive effect with sily-
`marin on methionine choline deficient (MCD)-diet-induced NAFLD in C57BL/6J mice.
`C57BL/6J mice were divided into five groups of normal (normal diet without any treatment),
`MCD diet (MCD diet only), MCD + silymarin (SIL) 100 mg/kg group, MCD + BDMC 100 mg/
`kg group, MCD + SIL 50 mg/kg + BDMC 50 mg/kg group. Body weight, liver weight, liver
`function tests, histological changes were assessed and quantitative real-time polymerase
`chain reaction and Western blot analyses were conducted after 4 weeks. Mice lost body
`weight on the MCD-diet, but BDMC did not lose less than the MCD-diet group. Liver
`weights decreased from BDMC, but they increased significantly in the MCD-diet groups.
`All liver function test values decreased from the MCD-diet, whereas those from the BDMC
`increased significantly. The MCD- diet induced severe hepatic fatty accumulation, but the
`fatty change was reduced in the BDMC. The BDMC showed an inhibitory effect on liver
`lipogenesis by reducing associated gene expression caused by the MCD-diet. In all experi-
`ments, the combinations of BDMC with SIL had a synergistic effect against MCD-diet mod-
`els. In conclusion, our findings indicate that BDMC has a potential suppressive effect on
`
`a11111
`
`OPEN ACCESS
`
`Citation: Kim S-B, Kang O-H, Lee Y-S, Han S-H,
`Ahn Y-S, Cha S-W, et al. (2016) Hepatoprotective
`Effect and Synergism of Bisdemethoycurcumin
`against MCD Diet-Induced Nonalcoholic Fatty Liver
`Disease in Mice. PLoS ONE 11(2): e0147745.
`doi:10.1371/journal.pone.0147745
`
`Editor: Giovanni Li Volti, University of Catania, ITALY
`
`Received: October 18, 2015
`
`Accepted: January 7, 2016
`
`Published: February 16, 2016
`
`Copyright: © 2016 Kim et al. This is an open access
`article distributed under the terms of the Creative
`Commons Attribution License, which permits
`unrestricted use, distribution, and reproduction in any
`medium, provided the original author and source are
`credited.
`
`Data Availability Statement: All relevant data are
`within the paper.
`
`Funding: This study was supported by the Basic
`Science Research Program through the National
`Research Foundation (NRF) of Korea funded by the
`Ministry of Education (NRF-2013R1A1A2064673),
`2013060380, the Korea government (MSIP) (2008-
`0062484), and Cooperative Research Program for
`Agriculture Science & Technology Development
`(Project No. PJ00962201), Rural Development
`Administration, Republic of Korea.
`
`PLOS ONE | DOI:10.1371/journal.pone.0147745 February 16, 2016
`
`1 / 15
`
`SAB1009
`U.S. Pat. No. 10,945,970
`
`

`

`Competing Interests: The authors have declared
`that no competing interests exist.
`
`NAFLD. Therefore, our data suggest that BDMC may act as a novel and potent therapeutic
`agent against NAFLD.
`
`Bisdemethoycurcumin Effect on Nonalcoholic Fatty Liver Disease
`
`Introduction
`Nonalcoholic fatty liver disease (NAFLD) affects a large population in the world [1]. It is pri-
`marily associated with the metabolic syndrome including insulin resistance, diabetes, obesity,
`hyperlipidemia [2] [3]. Especially, obesity is an alarming public health big issue because it
`causes metabolic syndromes, such as type 2 diabetes, hypertension, cardiovascular disease,
`NAFLD, and insulin resistance [4]. Hepatic steatosis is defined by the presence of cytoplasmic
`triglyceride (TG), droplets in > 5% of hepatocytes in the absence of significant alcohol con-
`sumption [5]. It is recognized as a decisive “first-hit” in the pathogenesis of liver disease [5].
`But, the “first hit” sensitives the liver to injury mediated by the “second hit”, such as adipo-
`kines, oxidative stress, inflammatory cytokines and mitochondrial dysfunction, leading to non-
`alcoholic steatohepatitis (NASH) [6]. NAFLD, there is a tendency to develop in obese or
`diabetic patients. It has most of the adult liver steatosis of obesity, at least, one third of these
`individuals will develop a worsening NAFLD [7] [8]. In addition, the prevalence of NAFLD
`will likely to increase obesity rate.
`Recently, natural herbs and food material have been the focus of many researchers because
`of their safety and efficacy, and potential bio-active ingredient to prevent or treat obesity and
`NAFLD [9] [10]. Curcumae longae rhizoma is a widely used traditional herb in many countries,
`and contains spice and yellow flavoring agent from the root of Curcuma longa L. [11]. It has
`been traditionally used to various diseases, such as hyperlipidemia, cancer, stomach ache, dia-
`betes mellitus, wounds, and hepatic disorders [12]. The main constitute of curcuma is curcu-
`min, which constitutes up to 90% of total curcuminoid content, with demethoxycurcumin and
`bisdemethoxycurcumin (BDMC) comprising the remainder [11]. This plant polyphenolic
`compound has anti-tumor, anti-proliferative, anti-oxidant, anti-fungal, anti-hepatotoxic, anti-
`diabetic and anti-inflammatory activities, as well as some side effects [12]. In particular, curcu-
`min has been demonstrated anti-adipogenic effect in 3T3-L1 cell model [13] [14]. Pharmaco-
`logical studies have compared the efficacy with steatohepatitis induced by a methionine and
`choline deficient (MCD)-diet model and HepG2 cells model [15]. However, the mechanism by
`which BDMC exerts its hepatoprotective effects has not yet been fully uncovered. Silymarin is
`a polyphenolic flavonoid isolated from milk thistle Silybum marianum, it’s widely used liver
`protective agent against hepatotoxicity. So, we evaluated the efficacy of BDMC in preventing
`steatohepatitis in mice and investigated the underlying mechanism. Also, we tested whether
`BDMC has combinatory hepatoprotective effect with silymarin on MCD-diet mice model.
`
`Materials and Methods
`Materials
`Bisdemethoxycurcumin (BDMC, Fig 1) was purchased from TCI America (Portland, OR,
`USA). Silymarin (SIL) was purchased from Sigma-Aldrich (St Louis, MO, USA). Anti-β-actin,
`peroxisome proliferator activated receptor (PPAR)-α, γ, CCAAT/enhancer binding protein
`(C/EBP) α, sterol regulatory element binding protein (SREBP), fatty acid synthase (FAS) anti-
`bodies were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Interleukin (IL)-
`6 and tumor necrosis factor (TNF)-α antibodies and biotinylated antibodies for mouse IL-6
`and TNF-α were purchased from BD Biosciences (San Jose, CA, USA). Anti-pThr172- 5'
`
`PLOS ONE | DOI:10.1371/journal.pone.0147745 February 16, 2016
`
`2 / 15
`
`

`

`Bisdemethoycurcumin Effect on Nonalcoholic Fatty Liver Disease
`
`Fig 1. Chemical structure of BDMC.
`
`doi:10.1371/journal.pone.0147745.g001
`
`AMP-activated protein kinase (AMPK) and anti-AMPK antibodies were purchased from Cell
`Signaling Technology (Beverly, MA, USA). SREBP-1c, PPAR-α, PPAR-γ, FAS, and GAPDH
`oligonucleotide primers were purchased from Bioneer Corp. (Daejeon, Korea).
`
`Animal care and diet preparation
`Seven-week-old male C57BL/6J mice were obtained from Samtaco Korea (Seoul, Korea). The
`mice were given free access to water and kept at a constant room temperature under a 12/
`12-hour light/dark cycle. They were allowed to adapt to their food and environment for 1 week
`before starting the experiment. The C57BL/6 mice were divided into 5 groups (7 mice per
`group) and its group shown in Table 1. Namely, normal diet (Dyets Inc., Bethlehem, PA,
`USA), MCD diet (Dyets Inc., Bethlehem, PA, USA), SIL 100 (MCD diet supplemented with
`silymarin 100 mg/kg/day), BDMC 100 (MCD diet supplemented with BDMC 100 mg/kg/day),
`SIL 50+BC 50 (MCD diet supplemented with silymarin 50 mg/kg/day + BDMC 50 mg/kg/day)
`was orally administered by gavages to the mice daily during the 4 weeks of diet feeding. The
`composition of the experimental diet was shown in Table 2. After four weeks, animals were sac-
`rificed via CO2 inhalation for the collection of blood and liver samples. The investigation con-
`forms to the Guide for the Care and Use of Laboratory Animals published by the US National
`Institute of Health (NIH Publication No. 85–23, revised 1996) and was approved by the Insti-
`tutional Animal Care and Utilization Committee for Medical Science of Wonkwang University
`(Approval no.WKU-15-100).
`
`Histological examination
`The formalin was exchanged for fresh solution of the liver slices fixed in 10% formalin (para-
`formaldehyde [Junsei Chemical Co., Ltd, Tokyo, Japan] and phosphate-buffered saline [PBS,
`pH 7.4]) overnight. Each formalin-fixed liver sample was embedded in paraffin and sliced into
`4-μm-thick sections. The slides were stained with hematoxylin and eosin (H&E) and evaluated
`by three investigators.
`
`Table 1. The experimental groups.
`
`Mouse model
`
`C57BL/6J
`
`doi:10.1371/journal.pone.0147745.t001
`
`Treatment (mg/kg/day)
`
`Normal
`MCD
`MCD+Silymarin (100 mg)
`MCD+BDMC (100 mg)
`MCD+SIL (50 mg)+BDMC (50 mg)
`
`Normal
`MCD
`SIL 100
`BDMC 100
`SIL 50+BC 50
`
`PLOS ONE | DOI:10.1371/journal.pone.0147745 February 16, 2016
`
`3 / 15
`
`

`

`Bisdemethoycurcumin Effect on Nonalcoholic Fatty Liver Disease
`
`Table 2. Constituents of experimental diet.
`
`Ingredient
`
`L-Arginine
`L-Histidine
`L-Lysine HCl
`L-Tyrosine
`L-Tryptophan
`L-Phenylalanine
`L-Methionine
`L-Cystine
`L-Threonine
`L-Leucine
`L-Isoleucine
`L-valine
`Glycine
`L-Proline
`L-Glutamic Acid
`L-Alanine
`L-Aspartic Acid
`L-Serine
`Cornstarch
`Dextrin
`Sucrose
`Celluose (401855)
`Corn Oil
`SaltMix20000
`Sodium Bicarbonat
`choline bitartrate
`VitaminMix 300050
`Primex
`FerricCitrate, U.S.P.
`Total
`
`Normal diet (gm/kg)
`
`MCD-diet (gm/kg)
`
`16.2
`6.4
`13.8
`8.7
`2.8
`11.8
`4.4
`3.9
`9.2
`20.2
`8.8
`11.7
`0
`0
`0
`0
`0
`0
`100
`100
`408.58
`50
`50
`35
`4.3
`2
`10
`100
`0.12
`1000.0
`
`12.7
`3.4
`9.1
`5.7
`1.8
`7.3
`0
`3.7
`4.6
`10.5
`6.1
`6.3
`6.2
`7.6
`28.9
`5.1
`15.8
`7.2
`100
`100
`408.58
`50
`50
`3.5
`4.3
`0
`10
`100
`0.12
`1000.0
`
`doi:10.1371/journal.pone.0147745.t002
`
`Biochemical analysis
`Serum TG, total cholesterol (TC), alanine aminotransferase (ALT) and aspartate aminotrans-
`ferase (AST) were estimated using a commercial enzymatic kit (Asan, Seoul, Korea). As
`described in detail, liver was homogenized in 0.5 mL 1 M NaCl. The liver tissue homogenate
`was extracted with 3 mL chloroform/methanol (2:1) plus 0.5 mL 1 M NaCl. The organic phase
`was collected, dried, and resuspended in 0.5 M Triton X-100/methanol (2:1). Hepatic TG, TC,
`ALT, and AST were determined using a commercial enzymatic kit (Asan, Seoul, Korea).
`
`Cytokine release analysis
`Blood samples were collected after an 18 h overnight fast in sacrificed animals to determine the
`IL-6 and TNF-α concentration. Peripheral serum was subjected to enzyme-linked immunosor-
`bent assay (ELISA) using IL-6 and TNF-α kit BD Biosciences (San Jose, CA, USA). Absorbance
`was read at 450 nm using a microplate reader (Biotec, Chicago, IL, USA). Samples and stan-
`dards were run three times.
`
`PLOS ONE | DOI:10.1371/journal.pone.0147745 February 16, 2016
`
`4 / 15
`
`

`

`Bisdemethoycurcumin Effect on Nonalcoholic Fatty Liver Disease
`
`Western blot analysis
`Protein expression was assessed by Western blot analysis according to standard procedures.
`Namely, the liver was homogenized in RIPA lysis buffer (iNtRON biotech, Daejon, Korea) on
`ice. The homogenates were centrifuged (13,000 rpm, 10 min, 4°C), and the protein concentra-
`tions in the supernatant were determined using the Bio-Rad protein assay reagent (Bio-Rad
`Laboratories, Hercules, CA, USA) according to the manufacturer’s instructions. Equal amounts
`of protein (20 μg) were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis
`and transferred to a polyvinylidene membrane (Millipore, Bedford, MA, USA). The membrane
`was blocked for 1 hour with 5% skim milk in Tris-buffered saline buffer (150 mM NaCl and 20
`mM Tris-HCl, pH 7.4) with 0.05% Tween 20. The membrane was incubated with primary anti-
`bodies for 18 h, washed with Tris-buffered saline with Tween 20, and incubated with anti-
`mouse or anti-rabbit immunoglobulin G horseradish peroxidase-conjugated secondary anti-
`bodies. The proteins were supplemented with the ECL prime Western blotting detection
`reagents (GE Healthcare, Parsippany, NJ, USA) and ImageQuant LAS 4000 Mini Biomolecular
`Imager (GE Healthcare, Parsippany, NJ, USA) was used to evaluate the bands, which were
`quantified by Image j.
`
`Quantitative real-time polymerase chain reaction analysis (qRT-PCR)
`Total-RNA was extracted from livers using an easy-BLUE total-RNA extraction kit according
`to the manufacturer’s instructions. Single-strand cDNA synthesis was performed using the
`Quantitact reverse transcription kit according to the manufacturer’s instructions. The RT-PCR
`analysis was performed with a QuantiTect™ SYBR Green PCR. The RT-PCR data were based
`on SYBR green amplification. The primer sequences are listed in Table 3. mRNA was detected
`for PPARα, PPARγ, SREBP-1c, Fas, C/EBPα, and GAPDH using the LightCycler system (Bio-
`Rad, Hercules, California, U.S.A.). Each sample was run and analyzed in duplicate.
`
`Statistical analysis
`The statistical analysis was performed with one-way analysis of variance using IBM SPSS Sta-
`tistics 19 (IBM Corp., Armonk, NY, USA). Data are presented as means ± standard deviations.
`
`Results
`Effects of BDMC on body weight and liver index of mice fed with MCD diet
`Body weight was measured from the beginning and the end of the experiment, at the terms of 2
`days. Mice fed the MCD diet lost significant body weight compared with mice fed the control
`diet. The same observations were made for liver weight (Table 4).
`
`Table 3. Primer sequences for real-time RT-PCR.
`
`Target genes
`
`SREBP-1c
`PPARα
`C/EBP
`PPARγ
`FAS
`GAPDH
`
`doi:10.1371/journal.pone.0147745.t003
`
`Primer sequences
`
`Forward primer
`
`CATCGACTACATCCGCTTCTTACA
`TGGAGTCCACGCATGTGAAG
`GCC GAG ATA AAG CCA AAC AA
`TTT TCA AGG GTG CCA GTT TC
`TGGTGGGTTTGGTGAATTGTC
`AAC TTT GGC ATT GTG GAA GG
`
`Reverse primer
`
`GTCTTTCAGTGATTTGCTTTTGTGA
`CGCCAGCTTTAGCCGAATAG
`CCT TGA CCA AGG AGC TCT CA
`TTA TTC ATC AGG GAG GCC AG
`GCTTGTCCTGCTCTAACTGGAAGT
`GGA TGC AGG GAT GAT GTT CT
`
`PLOS ONE | DOI:10.1371/journal.pone.0147745 February 16, 2016
`
`5 / 15
`
`

`

`Bisdemethoycurcumin Effect on Nonalcoholic Fatty Liver Disease
`
`Table 4. Effect of BDMC on MCD diet body weight and liver weight.
`
`Normal (mg/kg/day)
`
`MCD (mg/kg/day)
`
`MCD+ SIL 100
`(mg/kg/day)
`
`MCD+ BDMC 100
`(mg/kg/day)
`
`MCD+ SIL 50+BC 50
`(mg/kg/day)
`
`Body weight (g)
`Initial
`Final
`Liver weight (g)
`
`22.2±2.2
`25.5±2.3
`0.89±0.02
`
`22.1±2.6
`15.2±1.7a
`1.36±0.06a
`
`23.6±3.6
`17.3±1.6*
`0.85±0.03**
`
`23.8±1.5
`19.4±1.5**
`0.51±0.06**
`
`22.9±3.5
`18.6±4.3**
`0.65±0.02**
`
`Data are expressed as mean ± SD from 7 animals where ap < 0.05 as compared to normal;
`*p < 0.05,
`**p < 0.01, as compared with the MCD group.
`
`doi:10.1371/journal.pone.0147745.t004
`
`Effects of BDMC on circulating ALT and AST levels
`Mice fed the MCD diet for 4 weeks developed severe steatohepatitis, with an associated eleva-
`tion in the plasma AST and ALT. Circulating ALT and AST levels are a consequence of hepato-
`cyte damage in NAFLD. Circulating ALT level decreased in the BDMC 100 and SIL 50 + BC 50
`treated groups compared to that in the MCD-diet mice. Respectively, treatment with BDMC
`100 inhibited this elevation in the plasma ALT and AST concentration (Fig 2).
`
`Fig 2. Effects on ALT and AST levels in mice. Mice were fed a control diet or the MCD diet for 4 weeks.
`Blood samples were collected, and plasma ALT (A) and AST (B) levels were determined. Mean ± standard
`deviation from seven animals is presented. ##p < 0.01 vs. normal control; *p < 0.05, **p < 0.01, vs. the MCD
`group.
`
`doi:10.1371/journal.pone.0147745.g002
`
`PLOS ONE | DOI:10.1371/journal.pone.0147745 February 16, 2016
`
`6 / 15
`
`

`

`Bisdemethoycurcumin Effect on Nonalcoholic Fatty Liver Disease
`
`Effects of BDMC on histological evaluation of hepatic steatosis
`Hepatic steatosis appears excess lipid accumulation in hepatic parenchymal cells. Hepatic stea-
`tosis manifests as an accumulation of large macrovesicular or small microvesicular intracyto-
`plasmic lipid droplets in hepatocytes. The diagnosis of steatosis is made when lipid content in
`the liver exceeds 5% by weight. The hallmark feature of NAFLD is steatosis. We examined the
`intrahepatic TG content in C57BL/6J mice to determine whether BDMC 100 and SIL 50 +
`BDMC 50 affected MCD-induced hepatic steatosis. Intrahepatic TG content increased in
`MCD-diet mice compared with that in normal mice (Fig 3). However, the BDMC 100 and SIL
`50 + BDMC 50 treated mice showed lower intrahepatic TG contents than that of the MCD-
`diet mice. In particular, steatosis in the BDMC 100-treated mice completely almost
`disappeared.
`
`Effects of BDMC on TG and TC accumulation induced by MCD
`We determined serum and liver TG and TC levels to examine the effect of BDMC on biochem-
`ical changes. The TG and TC levels increased significantly in MCD group compared to those
`in the control group. The BDMC 100 and SIL 50 + BDMC 50 groups showed significantly
`lower serum and liver TG and TC levels (Table 5).
`
`Effects of BDMC on hepatic lipid accumulation and protein expression
`A Western blot analysis was performed the expression of adipogenic transcription factors and
`enzymes. The increases in FAS, C/EBPα, PPARγ, and SREBP-1 were suppressed significantly
`after treatment with BDMC 100 and SIL 50 + BDMC 50 (Fig 4). The FAS, C/EBPα, PPARγ,
`and SREBP-1 expression levels decreased.
`
`Effects of BDMC on hepatic lipogenic gene mRNA expression
`Excess accumulation of stored lipid often leads to disorders, such as obesity and NAFLD. Gene
`related to fatty acid synthesis are generally upregulated in NAFLD. Hepatic lipogenesis rates
`are controlled by key transcription factors and metabolic enzymes, including SREBP1c and
`FAS. We measured the lipogenic gene mRNA levels to determine whether BDMC 100 and SIL
`50 + BC 50 inhibited their expression. SREBP1c, PPARγ, C/EBP, and FAS mRNA levels in the
`
`Fig 3. Histological analysis of liver steatosis and liver morphology. (A) Photographs of mice liver are shown. (B) C57BL/6J mice were fed a normal diet,
`the MCDdiet, or the same MCD diet supplemented with either treatment for 4 weeks. Liver sections were stained with hematoxylin and eosin. Original
`magnification, ×100 (B).
`
`doi:10.1371/journal.pone.0147745.g003
`
`PLOS ONE | DOI:10.1371/journal.pone.0147745 February 16, 2016
`
`7 / 15
`
`

`

`Bisdemethoycurcumin Effect on Nonalcoholic Fatty Liver Disease
`
`Table 5. Biochemical liver function effects of the MCD-diet in C57BL/6J mice.
`
`Normal (mg/kg/day)
`
`MCD (mg/kg/day)
`
`MCD BDMC100 (mg/kg/day)
`
`MCD SIL50+BC50 (mg/kg/day)
`
`Serum (mg/L)
`TC
`TG
`HDL
`LDL
`Liver (mg/total tissue)
`TC
`TG
`HDL
`LDL
`
`53.1±2.5
`55.2±1.5
`45.5±1.4
`18.6±2.5
`
`35.5±5.2
`39.7±4.3
`28.6±4.5
`14.8±5.2
`
`87.5±2.5 a
`93.2±8.7 a
`27.5±6.5 a
`78.6±2.5a
`
`39.2±6.13
`108.8±5.1a
`26.6±1.25
`34.3±1.2a
`
`40.5±1.2**
`48.2±1.5**
`43.2±3.2*
`6.9±0.8**
`
`38.4±3.1
`42.5±7.5**
`27.2±4.2
`19.7±2.3*
`
`45.5±2.5*
`53.6±5.2**
`42.5±2.6*
`13.7±1.2**
`
`39.5±1.6
`62.8±6.4*
`26.3±1.2
`25.7±5.2
`
`The actual values of mean ± SD from 7 animals are presented. ap < 0.05 as compared to normal;
`*p < 0.05,
`**p < 0.01, as compared with the MCD group.
`MCD; methionine-choline.deficient diet, TG; triglyceride, TC; total cholesterol, HDL; high-density lipoprotein, LDL; low-density lipoprotein.
`
`doi:10.1371/journal.pone.0147745.t005
`
`BDMC 100 and SIL 50 + BDMC 50-treated mice decreased compared to those in MCD mice
`(Fig 5).
`
`Effects of BDMC on hepatic fatty acid oxidation and expression
`Western blot analysis was performed to measure the expression of β-oxidation transcription
`factors and enzymes to demonstrate the effects of BDMC 100 and SIL 50 + BDMC 50 on fatty
`
`Fig 4. Effects on hepatic lipid accumulation and protein expression. PPAR-γ, C/EBPα, SREBP-1c, and
`FAS protein expression levels were detected by Western blot analysis. Expression levels were normalized to
`those of the β-actin protein. Mean ± standard deviation from seven animals is presented. ##p < 0.01 vs.
`normal; *p < 0.05, **p < 0.01 vs. control.
`
`doi:10.1371/journal.pone.0147745.g004
`
`PLOS ONE | DOI:10.1371/journal.pone.0147745 February 16, 2016
`
`8 / 15
`
`

`

`Bisdemethoycurcumin Effect on Nonalcoholic Fatty Liver Disease
`
`Fig 5. Hepatic lipogenesis gene mRNA expression levels. Data are representative of three independent experiments and quantified by densitometric
`analysis. mRNA expression levels were evaluated by real-time polymerase chain reaction and normalized to GAPDH levels. Data are mean ± standard
`deviation (n = 7, each). ##p < 0.01 vs. normal; *p < 0.05, **p < 0.01 vs. control.
`
`doi:10.1371/journal.pone.0147745.g005
`
`acid oxidation and protein levels. PPARα expression increased significantly after the BDMC
`100 and SIL 50 + BDMC 50 treatments (Fig 6A). Also, we measured fatty acid oxidation gene
`mRNA expression to investigate the molecular hepatic lipid metabolic mechanism after the
`BDMC 100 and SIL 50+BDMC 50 treatments. Hepatic PPARα and its target enzymes are
`responsible for hepatic fatty acid oxidation. PPARα is a mitochondrial regulatory enzyme that
`transfers fatty acids from the cytosol to the mitochondria prior to β-oxidation. PPARα expres-
`sion increased significantly after the BDMC 100 and SIL 50 + BDMC 50 treatments (Fig 6B).
`
`Effects of BDMC on MCD diet-induced hepatic inflammation
`The inhibitory activities of the BDMC 100 and SIL 50 + BDMC 50 on TNF-α and IL-6 levels
`were tested with an ELISA. As shown in Fig 7, in serum TNF-α and IL-6 concentrations
`increased significantly on the MCD group. In addition, TNF-α and IL-6 concentrations
`decreased in mice treated with BDMC 100 and SIL 50 + BDMC 50, compared with that in the
`MCD group, suggesting that the BDMC 100 and SIL 50 + BDMC 50 treatments markedly
`inhibited TNF-α and IL-6 secretion.
`
`Effects of BDMC on AMPK phosphorylation
`We examined the effect of the BDMC 100 and SIL 50 + BDMC 50 treatments on AMPK phos-
`phorylation of liver proteins to examine whether they activate the AMPK pathway. Phosphory-
`lated AMPK decreased in the MCD group but increased significantly in the BDMC 100, and
`SIL 50+ BDMC 50 groups compared to that of the MCD group (Fig 8). Thus, the BDMC 100
`and SIL 50 + BDMC 50 treatments may have a beneficial effect on NAFLD induced by MCD.
`
`PLOS ONE | DOI:10.1371/journal.pone.0147745 February 16, 2016
`
`9 / 15
`
`

`

`Bisdemethoycurcumin Effect on Nonalcoholic Fatty Liver Disease
`
`Fig 6. Effects on hepatic fatty acid oxidation and expression. (A) PPARα protein expression was detected by Western blot analysis. Expression levels
`were normalized to those of the β-actin protein. Mean ± standard deviation from seven animals is presented. #p < 0.05 vs. normal; *p < 0.05 vs. control. (B)
`Fatty acid oxidation gene mRNA expression. Data were representative of three independent experiments and quantified by densitometric analysis. mRNA
`expression levels were evaluated by real-time polymerase chain reaction and normalized to GAPDH levels. Data are mean ± standard deviation (n = 7 each).
`##p < 0.01 vs. normal; *p < 0.05, **p < 0.01 vs. control.
`
`doi:10.1371/journal.pone.0147745.g006
`
`Fig 7. Effects on AMPK phosphorylation. AMPK phosphorylation (pThr-172-AMPK) was detected by
`Western blot analysis. Expression levels were normalized to that of the AMPK protein. Numbers below the
`panels represent quantification of the Western blot by densitometry. Mean ± standard deviation are
`presented (n = 7). ##p < 0.01 vs. normal; *p < 0.05, **p < 0.01 vs. control.
`
`doi:10.1371/journal.pone.0147745.g007
`
`PLOS ONE | DOI:10.1371/journal.pone.0147745 February 16, 2016
`
`10 / 15
`
`

`

`Bisdemethoycurcumin Effect on Nonalcoholic Fatty Liver Disease
`
`Fig 8. Effects on IL-6 and TNF-α concentrations. Mice were fed a control diet or the MCD diet for 4 weeks. Blood samples were collected, and plasma IL-6
`(A) and TNF-α (B) concentrations were determined. Mean ± standard deviation are presented (n = 7). ##p < 0.01 vs. normal; *p < 0.05, **p < 0.01 vs. control.
`
`doi:10.1371/journal.pone.0147745.g008
`
`Discussion
`NAFLD is a liver symptom of metabolic syndrome. It has become one of the most common
`causes of chronic liver disease over the past 10 years in developed countries [16]. NAFLD con-
`tains a spectrum of pathological hepatic changes, such as steatohepatitis, steatosis, advanced
`fibrosis, and cirrhosis [17]. Feeding mice a methionine and choline deficient (MCD) diet leads
`to the development of steatohepatitis with fibrosis and serves an animal model for NAFLD
`[18]. The MCD diet is essential for hepatic β-oxidation and production of very low density
`lipoproteins (VLDL), choline deficiency impairs hepatic VLDL secretion [18]. Consequentially,
`lipid is accumulated in the liver. In addition, cytokines changes, oxidative stress, adipocyto-
`kines occur, contributing to the liver injury [19] [20].
`Curcumae longae rhizoma is a plant in the Zingiberaceae family that provides a yellow fla-
`vorful powder when dried and ground. It is valued worldwide as a functional food because of
`its health promoting properties [21]. Several reports have indicated a variety of pharmacologi-
`cal activities of turmeric, such as antimicrobial, antiparasitic, antimutagenic, anticancer, anti-
`oxidant, anti-inflammatory and anti-human immunodeficiency virus [22–25]. It is effective for
`treating liver diseases, circulatory problems, and dermatological disorders [26–28]. The
`
`PLOS ONE | DOI:10.1371/journal.pone.0147745 February 16, 2016
`
`11 / 15
`
`

`

`Bisdemethoycurcumin Effect on Nonalcoholic Fatty Liver Disease
`
`pharmacological activities of turmeric have been attributed to the ethanol extract, which con-
`tain three different curcuminoid pigments form the yellow color of turmeric, consist of curcu-
`min, methoxy curcumin, demethoxy curcumin, and BDMC [29]. A previous study reported a
`hepatoprotective action of Curcumae longae rhizoma [14]. Additional studies have demon-
`strated that curcumin, demethoxycurcumin and BDMC have hepatoprotective activities [15].
`However, no information is available about the effect of BDMC on NAFLD. In this study, we
`examined the hepatoprotective effect and underlying mechanism of BDMC in MCD-diet mice.
`Additionally, we tested BDMC may be used liver potent agents to be used in combating drug
`on NAFLD. Also, Silymarin (SIL) has been demonstrated that improves hepatic and myocar-
`dial injury in experimental nonalcoholic fatty liver disease and it used as a positive control
`[30]. To investigate the synergistic activity of BDMC with SIL, we used a half of capacity.
`The MCD- diet model is associated with loss of body weight [31]. Thus, mice fed with the
`MCD diet lost significant body weight compared with mice fed the normal diet. However, add-
`ing BDMC to the MCD diet did not lead to further weight loss (Table 4). Silymarin (SIL) used
`positive control. The MCD diet also increased hepatic TG and serum ALT levels. But supple-
`menting with MCD+BDMC group markedly alleviated hepatic TG accumulation (Table 5),
`high serum ALT and AST level (Fig 2), histological findings (Fig 3). In particular, the BDMC
`100 group had significantly reduced values for these factors and SIL 50+ BDMC 50 group had
`a synergistic effect against MCD-diet models. Therefore BDMC protected the liver from dam-
`age when administered alone or in combination with SIL.
`Proinflammatory cytokines mediate the inflammatory response and apoptosis [32] [33].
`Especially, TNF-α has plays an important role in evolution of the steatohepatitis [34]. IL-6 is
`an inflammatory mediator of liver diseases, including obesity-associated fatty liver and cirrho-
`sis [35] [36]. In our study, BDMC alone or in combination with SIL significantly suppressed
`oxidative stress and reduced TNF-α and IL-6 expression. It’s suggesting that the anti-inflam-
`matory effects of BDMC may be partly related to inhibiting hepatic lipoperoxides and the
`expression of TNF-α and IL-6 (Fig 7).
`Also, AMPK controls the white adipose tissue metabolism, acts as a “metabolic regulator”.
`AMPK suppresses energy consumption, such as sterol synthesis and fatty acid in the biosyn-
`thetic pathways, and activated ATP-producing catabolic pathways. AMPK has been implicated
`that hepatic glucose and lipid homeostasis control through genes and by short-term regulation
`of specific enzymes [37]. Our results suggest that BDMC alone or in combination with SIL may
`have a suppressive effect on MCD-diet induced lipid accumulation in the liver by activating
`AMPK phosphorylation (Fig 8). FAS is an enzyme necessary for de novo fatty acid synthesis,
`which is regulated by SREBP-1c [38] [39]. Reduction in fatty acid synthesis was considered a
`protective response against hepatosteatosis. In Figs 4 and 5, BDMC alone or in combination
`with SIL treatment reduced SREBP-1c and FAS protein and mRNA levels. Feeding the MCD
`diet resulted in a significant increase of PPARγ expression, which may promote elimination of
`fatty acids, reduce free fatty acid uptake by the liver, and lower inflammation [40]. PPARα is
`essential for the metabolism regulation and lipid transport, mainly by peroxisomal fatty acid β-
`oxidation and mitochondria activation pathways [41]. Especially, PPARα protects against
`high-fat-diet or MCD-diet induced NASH in rodents [42–44]. The BDMC alone or in combi-
`nation with SIL showed reduced PPARγ and enhanced hepatic PPARα expression (Figs 4, 5
`and 6). We propose that BDMC through AMPK shutting down the anabolic pathway and pro-
`moting catabolism by upregulating PPARα and downregulating the activity of key lipid meta-
`bolic enzymes, such as, SREBP-1c, C/EBPα, and FAS. Consequently, BDMC suppressed fat
`accumulation in the liver and could be developed as a potential therapeutic treatment to reduce
`formation of a fatty liver.
`
`PLOS ONE | DOI:10.1371/journal.pone.0147745 February 16, 2016
`
`12 / 15
`
`

`

`Bisdemethoycurcumin Effect on Nonalcoholic Fatty Liver Disease
`
`Author Contributions
`Conceived and designed the experiments: SK YS DK. Performed the experiments: SK OK SH
`DK. Analyzed the data: OK RK YS DK. Contributed reagents/materials/analysis tools: SC YA
`YL. Wrote the paper: SK OK DK.
`
`2.
`
`4.
`
`9.
`
`10.
`
`14.
`
`References
`1. Cohen JC, Horton JD, Hobbs HH (2011) Human fatty liver disease: old questions and new insights. Sci-
`ence 24; 332(6037):1519–1523. doi: 10.1126/science.1204265 PMID: 21700865
`Li Y, Jadhav K, Zhang Y (2013) Bile acid receptors in non-alcoholic fatty liver disease. Biochem Phar-
`macol 1; 86(11):1517–1524. doi: 10.1016/j.bcp.2013.08.015 PMID: 23988487
`3. Neuschwander-Tetri BA (2010) Hepatic lipotoxicity and the pathogenesis of nonalcoholic steatohepati-
`tis: the central role of nontriglyceride fatty acid metabolites. Hepatology 52(2):774–788. doi: 10.1002/
`hep.23719 PMID: 20683968
`Zimmet P, Alberti KG, Shaw J (2001) Global and societal implications of the diabetes epidemic. Nature
`414:782–787. PMID: 11742409
`5. Begriche K, Igoudjil A, Pessayre D, Fromenty B (2006) Mitochondrial dysfunction in NASH: causes,
`consequences and possible means to prevent it. Mitochondrion 6:1–28. PMID: 16406828
`6. Starley BQ, Calcagno CJ, Harrison SA (2010) Nonalcoholic fatty liver disease and hepatocellular carci-
`noma: a weighty connection. Hepatology 51(5):1820–32. doi: 10.1002/hep.23594 PMID: 20432259
`7. Adams LA, Lymp JF, Sauver J St, Sanderson SO, Lindor KD, Feldstein A, et al. (2005) The natural his-
`tory of nonalcoholic fatty liver disease: a population-based cohort study. Gastroenterology 129:113–
`121. PMID: 16012941
`8. Browning JD, Szczepaniak LS, Dobbins R, Nuremberg P, Horton JD, Cohen JC, et al. (2004) Preva-
`lence of hepatic steatosis in an urban population in the United States: impact of ethnicity. Hepatology
`40:1387–1395. PMID: 15565570
`Jan