Molecular Immunology 39 (2003) 941–952
`
`Humanization of the anti-CD18 antibody 6.7: an unexpected effect
`of a framework residue in binding to antigen
`Cristina Caldas a,b, Verˆonica Coelho b, Jorge Kalil b, Ana Maria Moro c,
`Andrea Q. Maranhão a, Marcelo M. Br´ıgido a,∗
`a Departamento de Biologia Celular, Universidade de Bras´ılia, 70910-900 Bras´ılia, DF, Brazil
`b Immunology Laboratory, Heart Institute (InCor), University of São Paulo Medical School, 05403-000 São Paulo, SP, Brazil
`c Instituto Butantan, 05503-900 São Paulo, SP, Brazil
`
`Received 7 November 2002; accepted 6 February 2003
`
`Abstract
`
`Humanization of monoclonal antibodies by complementary determinant region (CDR)-grafting has become a standard procedure to
`improve the clinical usage of animal antibodies. However, antibody humanization may result in loss of activity that has been attributed
`to structural constraints in the framework structure. In this paper, we report the complete humanization of the 6.7 anti-human CD18
`monoclonal antibody in a scFv form. We used a germline-based approach to design a humanized VL gene fragment and expressed it
`together with a previously described humanized VH. The designed humanized VL has only 14 mutations compared to the closest human
`germline sequence. The resulting humanized scFv maintained the binding capacity and specificity to human CD18 expressed on the
`cell surface of peripheral blood mononuclear cells (PBMC), and showed the same pattern of staining T-lymphocytes sub-populations, in
`comparison to the original monoclonal antibody. We observed an unexpected effect of a conserved mouse–human framework position
`(L37) that hinders the binding of the humanized scFv to antigen. This paper reveals a new framework residue that interferes with paratope
`and antigen binding and also reinforces the germline approach as a successful strategy to humanize antibodies.
`© 2003 Elsevier Science Ltd. All rights reserved.
`
`Keywords: Humanization; Framework; CDR-grafting; CD18
`
`1. Introduction
`
`Antibody engineering has become a popular technol-
`ogy for development of a new generation of drugs (Presta,
`2002; Maynard and Georgiou, 2000). The amount knowl-
`edge available with regards to antibody structure at atomic
`resolution, allied to its conserved conformation, permits the
`elaboration of general rules for antigen binding site struc-
`tural and functional features. To date, the commonest an-
`tibody manipulation is the process of humanization. In this
`process, a murine antibody sequence is replaced by a ho-
`mologous human sequence yielding a human-like antibody,
`reducing its immunogenicity, and preserving the binding to
`the original antigen (Jones et al., 1986; Riechmann et al.,
`1988;Verhoeyen et al., 1988). This methodology has revo-
`lutionized the clinical use of monoclonal antibodies (mAb),
`
`Abbreviations: bp, base-pair; CDR, complementary determinant re-
`gion; Fab, antigen binding fragment; FR, framework; PCR, polymerase
`chain reaction; scFv, single chain variable fragment; mAb, monoclonal
`antibody; VL, variable light chain; VH, variable heavy chain
`∗ Corresponding author. Tel.: +55-61-3072423; fax: +55-61-3498411.
`E-mail address: brigido@unb.br (M.M. Br´ıgido).
`
`since the patients‘ response to heterologous rodent se-
`quences prevents the full biological effect of the monoclonal
`antibody (Winter and Harris, 1993). Moreover, heterologous
`mAbs present a reduced half-life and a diminished capac-
`ity to induce effector functions (Isaacs et al., 1992). The
`limit of this process is in the preservation of the antibody’s
`affinity and specificity. After a decade of research in this
`process, many rules have been established that help main-
`tain the overall antibody structure while the mouse primary
`sequence is being saturated with human residues. The use
`of human germline sequences (Rosok et al., 1996; Caldas
`et al., 2000) and the maintenance of key framework residues
`are examples of these rules (Tempest et al., 1991). Many
`successfully humanized antibodies have been reported, in-
`cluding in this group those that are already being routinely
`used in therapeutics (Glennie and Johnson, 2000).
`Antibody humanization is becoming a trivial methodol-
`ogy, where many different experimental procedures result
`in an active antibody. In spite of this, many of the designed
`human antibodies do not fully mimic the behavior of the
`original murine protein. Loss of affinity, specificity, or sta-
`bility are the main parameters affected by this experimental
`
`0161-5890/03/$ – see front matter © 2003 Elsevier Science Ltd. All rights reserved.
`doi:10.1016/S0161-5890(03)00022-1
`
`1 of 12
`
`OnCusp
`Ex. 1011
`
`

`

`942
`
`C. Caldas et al. / Molecular Immunology 39 (2003) 941–952
`
`procedure. Mild losses are normally associated with this
`procedure (Carter et al., 1992; Hsiao et al., 1994). A lower
`affinity is normally tolerated for humanized antibodies.
`These effects have been partially remedied by reengineer-
`ing the framework (Kettleborough et al., 1991; Singer et al.,
`1993; Nakatani et al., 1994; Zhu and Carter, 1995; Saldanha
`et al., 1999). Therefore, it is crucial to describe more sub-
`tle structural features that allow the preservation of antibody
`paratope integrity during this process. The rules are far from
`being completely understood. Long-range effects promoted
`by certain residues are among those forces responsible for
`subtle changes in the global structure. Unfortunately these
`are the most difficult issues to probe, since even small devia-
`tions could be responsible for removing residue–residue con-
`tact, or reducing surface complementarity. Therefore, even
`distant residues could interfere with paratope conformation
`and antigen binding (Chien et al., 1989).
`We used an anti-human CD18 as a model antibody for
`humanization. CD18 is an integrin family membrane protein
`involved in cell adhesion. It is found in many different cell
`types and it is always associated with one of the different
`isoforms of CD11. Antibodies to CD18 may inhibit cell–cell
`attachment and especially leukocyte-tissue adhesion. There-
`fore, anti-CD18 antibodies have been proposed as adjuvant
`in many therapies that involves leukocytes infiltration and
`inflammation. They have been tested successfully as protec-
`tive agents in ischemic myocardial injury in animal models
`(Gao et al., 2002), but much of this enthusiasm was lost
`after failure of human trials (Dove, 2000). Its potential ap-
`plication is much wider, and it has also been cited as a po-
`tential treatment for preventing meningitis sequels or graft
`rejection (Tuomanen et al., 1989; Isobe et al., 1997). The
`antibody used in this work, mAb 6.7, binds to CD18 (David
`et al., 1991) in a unique inhibitory epitope recently mapped
`to residues 350–432 (Lu et al., 2001).
`In this work we describe the complete humanization of
`murine mAb 6.7 anti-human CD18. In a previous paper we
`described the successful humanization of the VH domain
`by means of a germline human VH gene fragment sequence
`using an expanded CDR1 (CDR1 + H1) graft (Caldas et al.,
`2000). We apply this same concept to the design of two ver-
`sions of the humanized VL domain. While testing them, we
`have shown the effect of a mutation far from the antibody’s
`binding site that resulted in a loss of affinity for the intact
`CD18 molecule on the cell surface. We propose it could be
`the result of a new, unexpected effect of a residue that inter-
`feres with binding of the completely humanized scFv even
`though it is located at a distance from the binding site.
`
`2. Materials and methods
`
`2.1. Computational analysis
`
`Similarity analysis was initially performed using FASTA
`(Pearson, 2000) and the Swiss-prot database (Bairoch and
`
`Apweiler, 2000). Blastp (Altschul et al., 1997) was also used
`either through the IgBlast page (http://www.ncbi.nlm.nih.
`gov/igblast/) or to analyze the PDB database (Berman et al.,
`2000). Amino acid residues usage in mouse and human VL
`was calculated from all-mouse and all-human VL files from
`Kabat Database (Johnson and Wu, 2000), using perl scripts.
`Germline VL sequences were obtained from the IgBlast
`page. Clustal W (Higgins et al., 1996) was used for multi-
`sequence alignment that was visualized using BioEdit ver-
`sion 5.0.9 (http://www.mbio.ncsu.edu/bioedit/bioedit.html).
`Tri-dimensional structure was visualized using RASMOL
`version 2.6 (Bernstein, 2000). This version of RASMOL
`permits direct distance calculations, but we also used perl
`scripts to perform such calculations. Accessibility of each
`atom in PDB file was calculated using the program Surfrace
`version 1.1 (Tsodikov et al., 2002). Variable region number-
`ing follows Kabat’s convention (Kabat et al., 1991).
`
`2.2. Synthetic oligonucleotides
`
`The overlapping oligonucleotides used for the synthe-
`sis of the humanized versions were supplied by DNA-
`gency (Malvern, PA). The oligonucleotides used were: L1
`( 5′ AGAAGATCTGACGTGGTTATGACCCAAAGCCCC-
`TTGTCCCTGCCAGTCACTCTGGGC3′); L2 (5′GTGCA-
`CCAAGCGTTGGCTA GACCTGCAGCTTATAGAGGCA-
`GGCTGGCCCAGAGTGACTGG3′); L3L (5′CAACGCTT-
`GGTGCACACCAACGGTAACACCTACTTCCACTGGT-
`TTCTTCAAAGACCAGGACAG3′); L3Q (5′CAACGCTT-
`GGTGCACACCAACGGTAACACCTACTTCCACTGGT-
`TTCAACAAAGACCAGGACAG3′); L4 (5′AAAGAATCT-
`ATTGGAAACCTTGTAAATCAACAGACGGGGGCTCT-
`GTCCTGGTCTTTG3′); L5 (5′ TCCAATAGATTCTTTGG-
`AGTCCCAGACAGGTTTTCTGGCTCTGGTAGCGGGA-
`CTGATTTC3′); L6 (5′ATACACCCCGACATCCTCAGCT-
`TCTACCCTGGAAATTTTGAGTGTGAAATCAGTCCC-
`GCT3′); L7 (5′GATGTCGGGGTGTATTATTGTTCACAG-
`TCAACACATGTTCCCCGGACTTTCGGTGGTGGC3′ ) ;
`L8 (5′ACCATGGGCTCTCTTGATCTCGAGCTTTGTGC-
`CACCACCGAAAGT3′); EXTL1 (5′GC TAGTAGAAGAT-
`CT3′) and EXTL2 (5′CACACCATGGGCTCT3′).
`The 5′ L1 oligonucleotide contains a BglII restriction site
`and the 3′ L8 carries a NcoI and a XhoI site (these sites are
`underlined). The L3L and L3Q contain the codon change be-
`tween the two VL humanized versions in bold (see results).
`
`2.3. Assembly of the VL humanized versions
`
`The 6.7 VL sequence was previously determined (Caldas
`et al., 2000) and its amino acid sequence was used for a
`search for the closest human germline sequence. The closest
`human germline sequence chosen was used as a framework
`to graft the murine CDRs. The DNA fragments for two
`humanized VL versions were generated using eight overlap-
`ping oligonucleotides ranging from 45 to 63 bp, with 15 bp
`of complementarity, in a PCR-based-protocol. Aliquots of
`
`2 of 12
`
`OnCusp
`Ex. 1011
`
`

`

`C. Caldas et al. / Molecular Immunology 39 (2003) 941–952
`
`943
`
`10 pmol of each pair of complementary oligonucleotides
`were annealed separately in a 50 ␮l reaction containing
`9 mM Tris–HCl (pH 7.6), 13 mM MgCl2, 21 mM DTT and
`200 ␮M dNTPs. The samples were incubated in 400 ml of
`boiling water for 5 min and left standing until the water
`reached room temperature. Each pair of primers were elon-
`gated by the addition of 24 U DNA polymerase I (Klenow
`fragment, Biolabs) for 30 min at room temperature. The two
`pairs of primers coding for the N-terminus were mixed and
`amplified by PCR, and the same procedure was followed
`for the two pairs of primers coding for the C-terminus. The
`DNA fragments for the two N-terminus and C-terminus re-
`gions were amplified by 20 thermal cycles of 94 ◦C for 30 s,
`60 ◦C for 40 s and 72 ◦C for 2 min and analyzed in agarose
`gel. Finally, the full-length DNA fragment was amplified us-
`ing as DNA templates the amplified fragments from the first
`PCR, extracted directly from the agarose gel with a pipet
`tip. The 5′and 3′ external primers (EXTL1 and EXTL2)
`were used in this second PCR; the DNA fragments were
`PCR-amplified after 25 thermal cycles of 94 ◦C for 30 s,
`60 ◦C for 40 s and 72 ◦C for 2 min, purified with Quiaquick
`gel purification system (QIAGEN), using the manufacturer’s
`recommendation, cloned in the pGEM-T vector (Promega)
`and sequenced using the T7 Sequencing Kit (Pharmacia).
`
`2.4. Construction of the expression vectors
`
`The constructs that code for the humanized scFvs were as-
`sembled based on the pIg17hVH/mVL (Caldas et al., 2000)
`derived from pIg17Z22 (Brigido et al., 1993). In this sys-
`tem, the proteins can be expressed as a fusion product with
`a staphylococcal protein A domain, in order to allow the de-
`tection of the recombinant protein and also to facilitate the
`purification in an IgG sepharose chromatography column.
`The DNA fragments of the humanized VL were cloned in the
`vector pIg17hVH/mVL, which had its murine VL replaced
`by the humanized VLs, through digestion with BglII and
`NcoI. After the construction and verification of the expres-
`sion cassettes, these were transferred to the Pichia pastoris
`expression vector pPIg16 (Andrade et al., 2000) by replac-
`ing the existing scFv, through digestion with the restriction
`enzymes XmaI and EcoRI.
`
`2.5. Expression of the humanized scFvs in Pichia pastoris
`
`P. pastoris GS115 cells (Invitrogen, San Diego, CA) were
`grown in liquid medium and made competent by resuspen-
`sion in 1 M sorbitol. The cells were eletroporated by pulse
`discharge (1500 V, 25 ␮F, 400 ; Bio-Rad Gene Pulser) for
`5 ms in the presence of 5–10 ␮g of plasmid DNA linearized
`with SalI. This enzyme cuts within the plasmid-encoded
`HIS4 gene and favors homologous recombination with
`the endogenous, non-functional his4 gene of GS115 cells.
`Therefore, transformants (His+) were screened by their
`capacity to grow in the absence of histidine as described
`by the manufacturer (Invitrogen). Protein expression kinet-
`
`ics were determined by growing clones expressing the two
`humanized scFvs in 25 ml of BMGY medium (1% yeast
`extract, 2% peptone, 10 mM potassium phosphate, pH 6.0,
`1,34% yeast nitrogen base, 4 × 10−5% biotin, 1% glycerol)
`at 30 ◦C in a shaking incubator (250 rpm) until the culture
`reached A600 = 2.0–6.0. Cells were then centrifuged and
`resuspended in 100–200 ml of BMMY medium (which
`has 0.5% methanol instead of 1% glycerol of the BMGY
`medium, while the other components are the same) to in-
`duce protein expression. Cells were incubated for 4 days at
`30 ◦C in a shaking incubator (250 rpm). Aliquots of culture
`supernatants were taken daily, and examined by SDS–PAGE
`and Western blotting. For large scale expression, the clones
`were grown exactly the same way as above, for 80 h at
`30 ◦C under agitation. The supernatants were harvested
`following centrifugation and filtration through a 0.45 ␮m
`cellulose acetate filter. After the addition of 80 ␮g of Pep-
`statin A and 14 ␮g of PMSF to the supernatants, these were
`concentrated to about 5 ml using an ultrafiltrating stirred
`cell (Corning) with a membrane filter with a cut-off of
`10,000 Da according to manufacturer’s instructions.
`
`2.6. Purification of recombinant scFvs
`
`The concentrated supernatants were run through an IgG
`Sepharose 6B Fast Flow column (Pharmacia) previously ac-
`tivated by three alternating washes with 0.5 M acetic acid, pH
`3.4, and PBST (PBS and Tween 20, 0.1%) and finally equi-
`librated with PBS. ScFv fragments were eluted with 0.5 M
`acetic acid, immediately neutralized with 1.5 M Tris–HCl,
`pH 8.8. The purified proteins were dialyzed against PBS and
`quantified using the BCA Protein Assay Kit (Pierce).
`
`2.7. Flow cytometric analysis
`
`Peripheral blood mononuclear cells (PBMC) obtained
`from a normal individual by gradient centrifugation were
`used for immunofluorescence assays. Antibodies utilized
`were: recombinant Z22 scFv (Andrade et al., 2000) as a
`negative control; rabbit anti-human IgG-FITC (Dakopatts,
`Denmark; used in the second step of the indirect immunoflu-
`orescence reaction to bind to the protein A domain present
`in the recombinant anti-CD18 scFvs, through the Fc frag-
`ment); rabbit anti-mouse IgG (Sigma); 6.7 anti-CD18 FITC
`(Instituto Butantan-InCor, Brazil); anti-CD19PE (Dakopatts,
`Denmark); anti-CD3 FITC (Dakopatts, Denmark); anti-CD4
`FITC (Dakopatts, Denmark); anti-CD8 FITC (Dakopatts,
`Denmark) and anti-CD45RO PE (Pharmingen). The sample
`incubated with both anti-CD19PE and rabbit anti-human
`IgG-FITC was used to evaluate binding of the rabbit an-
`tibody to IgG expressed on B cells and exclude any other
`unspecific binding from the tests with the scFvs. Anti-CD3
`was used as a positive control of the assays. 2 × 105 cells
`were incubated with the different antibodies for 30 min
`at 4 ◦C and washed three times. For the samples with the
`recombinant humanized scFvs, a second incubation was
`
`3 of 12
`
`OnCusp
`Ex. 1011
`
`

`

`944
`
`C. Caldas et al. / Molecular Immunology 39 (2003) 941–952
`
`performed with rabbit anti-human IgG-FITC. All samples
`were resuspended in 400 ␮l of FACS buffer (PBS, 2%
`FCS and 0.01% sodium azide) and analyzed using a FAC-
`Scan flow cytometer (Becton Dickinson, CA, USA). Ten
`thousand events were analyzed for each sample, inside the
`gate of lymphocytes. Recombinant proteins were added in
`equimolar quantities. Results are expressed as the percent-
`age of stained cells. The antibodies anti-CD4, anti-CD8
`and anti-CD45RO were used in order to characterize the
`T-lymphocyte sub-populations that the humanized scFvs
`were able to bind.
`
`2.8. Blocking capacity of the humanized scFvs
`
`In order to analyze the binding specificity of the two hu-
`manized scFvs, a blocking experiment was performed. The
`capacity of the scFvs to block the binding of the original
`6.7 anti-CD18 FITC to surface CD18 molecules was tested.
`Cells were initially incubated with the two humanized scFvs,
`washed, incubated with rabbit anti-mouse IgG (to block the
`protein A domain present in the recombinant scFvs) and then
`incubated with 6.7 FITC. The percentage of positive cells
`and the intensity of immunofluorescence (IF) were com-
`pared in samples with 6.7 FITC alone and samples with the
`different humanized scFvs plus 6.7 FITC. The percentage
`of inhibition was calculated considering these differences.
`
`3. Results
`
`3.1. Selection of the framework Vκ and Jκ for
`CDR-grafting
`
`The human framework used to accept the murine CDRs
`was selected based on the closest germline sequence (Caldas
`
`et al., 2000). We used the FASTA program to search for
`human V␬ sequences deposited in the Swiss-prot database.
`The closest human sequence found was the germline V␬
`fragment KV2F (Klobeck et al., 1985) with 76% identity
`and 89% similarity to the mouse 6.7 V␬ gene fragment
`(AF135165). A similar result was obtained using the NCBI
`IgBlast tool. In this case, two human germline V␬ sequences
`exhibit good hits with the mouse V␬. The closest was the
`A17 (X63403) with 76% identity followed by the A18
`(X63396) with 74% identity (Lautner-Rieske et al., 1992).
`The alignment of the original anti-CD18 V␬ gene segment
`to the human related sequences is shown in Fig. 1. The
`A17 coding sequence is identical to the KV2F Swiss-prot
`record, while A18 is 81% identical (91% similar) to either
`A17 or KV2F. Either V␬ could be used for grafting the
`6.7 V␬ complementary determinant region (CDR), but the
`KV2F/A17 was chosen due to its closer proximity. The
`6.7 J␬ (AF135165) closest human J␬ gene segment is the
`J␬4 with only one difference. Thus the human germline J␬4
`sequence was chosen for completing the FR4 of the human-
`ized VL. The conservative V → L codon change observed
`in the recombinant FR4 (Fig. 1) is due to an XhoI site at
`the end of VL used for the expression vector manipulation.
`
`3.2. Identification of putative constraints
`
`The visual inspection of two of the closest murine (1MRC)
`and human (1AD9) Fab crystals suggests an overall con-
`served structure in the VL domain. The systematic survey of
`the tri-dimensional structure at the replacing residues reveals
`two positions that could be important for maintaining the
`framework structure. The murine residue Leu46 was found
`to be buried in the VH–VL interface. By using a cut-off
`distance of 4.0 Å, VL residue 46 makes many contacts
`
`Fig. 1. Design of anti-CD18 VL humanized versions. Amino acid sequence alignments of original murine VL (VL 6.7), closest human germline VL (Vk
`A17 and Vk A18) and humanized VL versions (VLCD18 (Q) and VLCD18 (L)). CDR residues, according to Kabat et al. (1991) are indicated. Asterisks
`indicate the residue 37 and 46, maintained in the humanized VL as discussed in the text. Jk residues are shown in italic.
`
`4 of 12
`
`OnCusp
`Ex. 1011
`
`

`

`C. Caldas et al. / Molecular Immunology 39 (2003) 941–952
`
`945
`
`including one to the LCDR 2 residue Phe55, two “Vernier”
`zone residues (Tyr36 and Trp35), framework residues Ile48,
`Val58, and the HCDR3 residues Asp101 e Gly97. There-
`fore, we decided to preserve the original murine Leu46 due
`to its array of contacts that includes contacts to VH and
`VL CDRs.
`Murine residue Leu37 was found to be superficially buried,
`making many contacts within the VL domain core. Its con-
`tact residues in 1MRC structure at 4.0 Å cut-off are: Pro44,
`Lys45, Leu47 and Tyr86. The Lys45 contact is one of the
`conserved hydrogen bonds involved in the maintenance of
`the variable domain structure (Chothia et al., 1985). In the
`1AD9 structure, Gln37 contacts the same subset of residues
`as above. The only discrepancy is a hypothetical hydrogen
`bond between the hydroxyl O of the Tyr86 and the amide
`N␰ of Gln37 (d = 282 Å). In the 1MRC VL, the residue
`37 is partially exposed to the solvent making a contact to a
`water molecule in the crystal. No water was found close to
`residue Gln37 in the VL of 1AD9. A survey of the Kabat
`database showed that position 37 is filled with either glu-
`tamine or leucine. For the mouse light chain, leucine appears
`in 20% of the antibodies while glutamine responds for 78%
`of all-mouse antibodies; other amino acid residues make up
`less than 3%. Similar numbers occur for human light chain.
`Due to its location in the VL-solvent interface and to its
`close proximity to the CDR1, we chose this position to con-
`struct two humanized versions for the VL domain of the
`6.7. The first construction carries the original L37 residue
`(named version L) while the other has the human germline
`Gln37 residue (version Q). Both constructions retained the
`murine Leu46 residue.
`
`3.3. Design of the recombinant humanized VL
`
`The complete humanized VL sequence was obtained by
`grafting the CDR1, 2 and 3 from the 6.7 VL in the proposed
`human germline V␬ (KV2F/A17) fused to J␬4 gene frag-
`ment. CDR1 was defined as residues 24 to 34 (24–39 in se-
`quential numbering), CDR2, as residues 50–56 (55–61), and
`CDR3, residues 89–97 (94–102), following the Kabat defi-
`nition (Kabat et al., 1991). The grafting process introduced
`six changes in CDR1, 2 in CDR2 and 5 in CDR3 of the hu-
`man VL, resulting in 13 differences out of the 32 residues
`in the CDRs. The complete humanized sequences are shown
`in Fig. 1. The final proposed humanized sequence had 12
`differences compared to the original 6.7 VL (89% identity)
`and 14 differences to the original V␬KV2F/A17/J␬4 (87.6%
`identity) in the Leu37 version (Fig. 1). The J␬ fragment was
`used as is, except for the Leu104 introduced by an XhoI site.
`The proposed recombinant VL was chemically synthesized
`for cloning in an scFv expression vector.
`
`3.4. Construction and expression of the humanized scFv
`
`As shown in Fig. 2, a set of ten oligonucleotides was
`used to generate the humanized VL using recombinant PCR
`
`as previously described for the VH domain (Caldas et al.,
`2000). Briefly, the primers were initially annealed, filled in
`by Klenow and then amplified as pairs until they reached
`the full sized VL (Fig. 2). The synthetic DNA fragment
`was cloned in pGEM-T easy vector. The recombinant clones
`were initially checked for size of insert prior to being repeat-
`edly sequenced. Several clones with the correct sized insert
`were tested and one clone (out of six) of the L version and
`one (out of 8) for Q version had a correct sequence. Correctly
`synthesized DNA inserts were digested with BglII and XhoI,
`and isolated from gel for cloning in the pIg17hVH/mVL
`plasmid cleaved with the same restriction endonucleases.
`This plasmid already harbored a hemi-humanized version
`of the 6.7 anti-CD18 scFv composed of a humanized VH
`fused to the original murine VL (Caldas et al., 2000). The
`cloning procedure eliminates the original murine VL, re-
`placing it with the synthetically humanized gene fragment.
`Two new constructions were obtained: pIg17hVH/hVL(L)
`and pIg17hVH/hVL(Q). For simplicity, these constructions
`were named pIg17LL and pIg17LQ, respectively. The whole
`scFv cassette, digested with XmaI/EcoRI, was used to re-
`place the scFv cassette of pPIg16, a P. pastoris expression
`vector (Andrade et al., 2000). According to the notation used
`above, the resulting plasmids were named pPIg LL and pPIg
`LQ.
`A protease defective strain of P. pastoris was used to re-
`ceive the expression vectors by electroporation. Both plas-
`mids were used to transform electrocompetent yeast cells.
`Many clones were obtained and screened for scFv produc-
`tion in the colony filter assay, where scFv producing cells
`were detected by immunostaining (Andrade et al., 2000).
`Two clones of each construction, found to be positive in the
`filter assay, were selected for growth on an analytical scale.
`In both cases, the detection of recombinant scFv was low.
`Filter assay positive clones were barely visible and the yield
`of purified scFv was also limiting. From 200 ml of yeast
`cultures, we normally obtained about 0.5–1 mg/l. Even so,
`we were able to purify around 1 mg of recombinant scFv
`of both L and Q version of the humanized anti-CD18 for
`further characterization.
`
`3.5. Immunological characterization of recombinant
`humanized antibodies
`
`The CD18 antigen is expressed at the cell surface of all
`leucocytes. Therefore, we tested the two variants of recom-
`binant humanized antibody (LL and LQ) directly for bind-
`ing to peripheral blood mononuclear cells (PBMC) by Flow
`Cytometry analysis. Our results show that the humanized
`LL version presents essentially the same binding capacity
`to lymphocytes as the original anti-CD18 monoclonal anti-
`body, staining 85% of gated cells. In contrast, the LQ ver-
`sion only stained 53% of the cells in the gate of lymphocytes
`(Fig. 3). The original 6.7 anti-CD18 mAb and an anti-DNA
`scFv were used as positive and negative controls, respec-
`tively. The small population stained with high intensity in
`
`5 of 12
`
`OnCusp
`Ex. 1011
`
`

`

`946
`
`C. Caldas et al. / Molecular Immunology 39 (2003) 941–952
`
`Fig. 2. The VL humanized versions were assembled using a PCR-based protocol. Arrows indicated the sense (→) and anti-sense (←) oligonucleotides
`used for VL synthesis. Two variations of the L3 oligonucleotides were synthesized (L3L and L3Q), that create the difference among the versions L and Q.
`
`the humanized versions of anti-CD18 was interpreted as un-
`specific staining, since it was also detected with anti-human
`IgG-FITC alone. The negative control anti-DNA scFv did
`not show any significant staining.
`The humanized scFvs were also able to compete effi-
`ciently with the 6.7 mAb for binding CD18 on lymphocytes,
`as shown in Fig. 4. In this experiment, decreasing dilutions
`of scFv were incubated with PBMC prior to incubation with
`the original anti-CD18 mAb. Both humanized versions were
`able to efficiently block the binding of the mAb to CD18
`molecules at the cell surface. Again, the LL version was
`also more efficient than LQ, blocking up to 80% of mAb’s
`binding activity in a 1:5 dilution.
`In order to compare the cell subsets recognized by the
`humanized LL version and the original murine antibody,
`we performed FACS analysis, using different markers. We
`found that both the original anti-CD18 and the human-
`ized LL version displayed the same pattern of staining
`to CD4+, CD8+ and to memory CD45RO+ lymphocytes
`(Fig. 5).
`
`4. Discussion
`
`The rules for transferring ligand specificity between donor
`and acceptor antibody are partially known. Today it is con-
`ceivable to transfer the CDR regions to a closely related
`framework acceptor, retaining the antibody’s specificity. The
`fact that the three-dimensional structure of the variable do-
`main is highly conserved makes this strategy feasible. In
`addition, the traditional model of antibody ontogeny relies
`on a flexible variable domain structure for evolving B cell
`response for an infinite antigen repertoire. Somatic hyper-
`mutation molds the final high affinity antibody. Such flexi-
`bility is so impressive that even Ig transgenic mice are able
`to make antibodies successfully even with a very limited Ig
`repertoire (Cascalho et al., 1996). It is likely that antibodies
`are made for binding, and transposing specificity is an opera-
`tion controlled by simple rules. When Wu and Kabat (1970)
`systematically analyzed the primary structure of the variable
`domain of antibodies, they observed that interspaced in the
`overall variable structure of the amino terminus domain of
`
`6 of 12
`
`OnCusp
`Ex. 1011
`
`

`

`C. Caldas et al. / Molecular Immunology 39 (2003) 941–952
`
`947
`
`Fig. 3. The scFv anti-CD18 humanized versions bind to human lymphocyte cell surface; 84, 53 and 85% of the cells were positive when incubated with
`the humanized scFv versions LL (A), LQ (B), or the original monoclonal anti-CD18 antibody (D), respectively. The Z22 anti-Z-DNA scFv was used as
`negative control (C).
`
`both heavy and light chain of antibody, there were hypervari-
`able regions. These regions were termed complementary de-
`termining regions after a new paradigm that implicates this
`region as the determinant for an antibody’s binding speci-
`ficity. This paradigm is still accepted today, and it is the basis
`of CDR-grafting (CDR replacement) as it was initially pro-
`posed by Jones et al. (1986). From that time on, transferring
`CDRs from mouse antibody to a human antibody framework
`became a general rule for antibody humanization.
`The first humanization procedures were based on trans-
`ferring mouse CDRs to human frameworks derived from
`known human antibodies. Even though this simple opera-
`
`Fig. 4. Humanized scFvs block the binding of anti-CD18 mAb FITC
`to CD18+ cells. Cells were incubated with different concentrations of
`recombinant humanized scFvs, washed, and then incubated with the mAb
`anti-CD18 FITC. The percentage of cells stained with the anti-CD18 mAb
`FITC after the addition of the humanized scFvs is shown.
`
`tion works, in most cases affinity was lost. To achieve an
`antibody with a better affinity, different authors have applied
`different strategies such as using other human framework V
`genes (Singer et al., 1993), exchanging sterically hindering
`residues (Zhu and Carter, 1995), or replacing residues that
`was known to interfere with CDR conformation (Tempest
`et al., 1991). Therefore the design of such humanized anti-
`bodies requires correction of the framework.
`In a broader view, most humanized antibodies lose part of
`their affinity compared to the original antibody (Studnicka
`et al., 1994; Tempest et al., 1995; Co et al., 1996). This
`loss is enhanced as the similarity of the chosen framework
`and the donor variable sequence decreases. Many authors
`elegantly demonstrated this framework effect (Tramontano
`et al., 1990; Foote and Winter, 1992; Studnicka et al., 1994).
`Tramontano et al. (1990) demonstrated the effect of the
`residue 71 heavy chain as a prototype of framework bias on
`the CDR conformation. Many other trending framework po-
`sitions were revealed by systematically analyzing antibody
`X-ray crystals (Foote and Winter, 1992; Studnicka et al.,
`1994). Thus, an influence of the framework in paratope
`assembling became widely accepted. It may appear con-
`tradictory because CDRs are the most variable portion of
`the variable domain, but recent studies bring evidence that
`CDRs indeed determine the overall shape of the paratope
`(Holmes and Foote, 1997; Holmes et al., 1998). The best
`scene is of a framework that sustains the paratope but may
`constrain certain conformational spaces. CDR would shape
`the paratope and bias the whole variable region structure in-
`side the framework intrinsic limitations.
`
`7 of 12
`
`OnCusp
`Ex. 1011
`
`

`

`948
`
`C. Caldas et al. / Molecular Immunology 39 (2003) 941–952
`
`Fig. 5. T cell subpopulations stained by the humanized LL version compared to the original mAb.
`
`In this report we synthesized the light chain variable re-
`gion as part of a humanized anti-human CD18 antibody. The
`strategy to design the humanized light chain variable region
`was based on the closest germline sequence (Caldas et al.,
`2000). Such a strategy allows us to reduce the framework
`derived constraints due to the use of the closest germline
`framework sequence. Many human germline sequences are
`available to date, facilitating the search for homologous V
`gene candidates (Tomlinson et al., 1995). After design we
`proceeded to the visual inspection of the three-dimensional
`structure of similar antibodies. In this step, we chose to use
`X-ray derived information instead of the molecular model
`for the humanized structure, because there is a large amount
`of data on crystal structures of antibodies in the PDB.
`(This is probably the most studied protein family at the
`three-dim