Downloaded from https://academic.oup.com/femsyr/article/7/1/141/492833 by The University of Texas at Austin user on 03 July 2024
`
`Multigene phylogenetic analysis of theTrichomonascus,
`Wickerhamiella andZygoascusyeast clades, and the proposal of
`Sugiyamaella gen. nov. and14 new species combinations
`Cletus P. Kurtzman & Christie J. Robnett
`
`Microbial Genomics and Bioprocessing Research Unit, National Center for Agricultural Utilization Research, Agricultural Research Service, U. S.
`Department of Agriculture, Peoria, IL, USA
`
`Abstract
`
`Relationships among species assigned to the ascosporic yeast genera Sporopachy-
`dermia, Stephanoascus, Trichomonascus, Wickerhamiella and Zygoascus, and to the
`associated anamorphic genera Arxula, Blastobotrys, Sympodiomyces and Trigonop-
`sis, were determined from phylogenetic analyses of gene sequences from the nearly
`complete large-subunit rRNA gene,
`the mitochondrial small-subunit rRNA
`gene, and cytochrome oxidase II. The genus Stephanoascus is polyphyletic,
`resulting in reassignment of two species to the older genus Trichomonascus and
`the third to Sugiyamaella gen. nov. (type species Sugiyamaella smithiae). The
`genera Sporopachydermia, Wickerhamiella and Zygoascus appear to be monophy-
`letic. The species Pichia ofunaensis and P. tannicola are proposed for transfer to
`Zygoascus. Arxula, Blastobotrys and Sympodiomyces are members of the Trichomo-
`nascus clade, with the genus Blastobotrys having taxonomic priority for ana-
`morphic states. Trigonopsis variabilis and three species of Candida represent a
`distinct clade. From the foregoing gene sequence analyses, the new ascosporic
`genus Sugiyamaella is proposed, as are 14 new species combinations and the new
`family Trichomonascaceae.
`
`Correspondence: Cletus P. Kurtzman,
`Microbial Genomics and Bioprocessing
`Research Unit, National Center for
`Agricultural Utilization Research, Agricultural
`Research Service, U. S. Department of
`Agriculture, 1815 North University Street,
`Peoria, IL 61604, USA. Tel.: 11309 681 6561;
`fax: 11309 681 6672; e-mail:
`kurtzman@ncaur.usda.gov
`
`Received 19 April 2006; revised 31 May 2006;
`accepted 2 June 2006.
`First published online 12 September 2006.
`
`DOI:10.1111/j.1567-1364.2006.00157.x
`
`Editor: Teun Boekhout
`
`Keywords
`yeasts; multigene phylogeny; Arxula;
`Blastobotrys; Sympodiomyces;
`Trichomonascus.
`
`Introduction
`
`Phylogenetic analysis of domains D1 and D2 (D1/D2) of
`large-subunit (26S) rRNA genes have shown that species of
`the ascosporic genera Stephanoascus, Wickerhamiella and
`Zygoascus are members of the same large clade (Kurtzman
`& Robnett 1995, 1998). Included in this clade were the
`anamorphic genera Arxula, Blastobotrys and Sympodiomyces,
`some species assigned to Candida, and possibly the genus
`Trigonopsis. Because deep lineages are seldom well resolved
`from phylogenetic analysis of a single gene, evolutionary
`relationships among the preceding genera were unclear.
`In the present study, we have analyzed members of this
`large clade from gene sequences of the nearly entire large-
`subunit rRNA gene, mitochondrial small-subunit rRNA
`gene and cytochrome oxidase II, and analysis of the com-
`bined gene sequences has provided much greater phyloge-
`netic resolution than obtained from the earlier D1/D2 rRNA
`gene studies. Furthermore, inclusion of 21 new species in
`this clade has provided added clarification of relationships.
`
`The new species included in the present analysis will be
`formally described in subsequent reports. An additional
`aspect of this work was the discovery of up to six introns in
`the large-subunit rRNA gene sequences of certain species.
`Intron evolution, as assessed from phylogenetic relation-
`ships among species, will be the subject of a future report. In
`the present study, phylogenetic circumscription of genera
`has been examined with multigene analysis, and the results
`have led to the proposal of a new ascosporic genus and 14
`new combinations of described species that are presently
`assigned to other genera.
`
`Materials and methods
`
`Organisms
`
`The strains studied are listed in Table 1, and all are
`maintained in the ARS Culture Collection (NRRL), National
`Center for Agricultural Utilization Research, Peoria, IL,
`USA.
`
`FEMS Yeast Res 7 (2007) 141–151
`
`c 2006 Federation of European Microbiological Societies
`Published by Blackwell Publishing Ltd. No claim to original US government works
`
`LCY Biotechnology Holding, Inc.
`Ex. 1025
`Page 1 of 11
`
`

`

`Downloaded from https://academic.oup.com/femsyr/article/7/1/141/492833 by The University of Texas at Austin user on 03 July 2024
`
`142
`
`C.P. Kurtzman & C.J. Robnett
`
`Table 1. Yeast strains compared in this study
`
`Strain designation
`
`Strain designation
`
`Species
`
`Arxula adeninivorans
`A. terrestris
`Blastobotrys arbuscula
`Bla. aristata
`Bla. capitulata
`Bla. elegans
`Bla. nivea
`Bla. proliferans
`Blastobotrys sp. n.
`Blastobotrys sp. n.
`Blastobotrys sp. n.
`Blastobotrys sp. n.
`Blastobotrys sp. n.
`Blastobotrys sp. n.
`Botryozyma nematodophila
`Candida auringiensis
`C. azyma
`C. bertae var. bertae
`C. blankii
`C. cantarellii
`C. caseinolytica
`C. castrensis
`C. chiropterorum
`C. drosophilae
`C. galacta
`C. ghanaensis
`C. litsaeae
`C. mokoenaii
`C. novakii
`C. ontarioensis
`C. paludigena
`C. pararugosa
`C. petrohuensis
`C. salmanticensis
`C. santjacobensis
`C. sorbophila
`C. spandovensis
`C. tartarivorans
`C. tepae
`C. valdiviana
`
`NRRL
`
`Y-17692T
`Y-17704T
`Y-17585T
`Y-17579T
`Y-17573T
`Y-17572T
`Y-17581T
`Y-17577T
`Y-6417T
`Y-6844T
`Y-7993T
`Y-27150T
`YB-1343T
`YB-2290T
`Y-17705T
`Y-17674T
`Y-17067T
`Y-17643T
`Y-17068T
`Y-17650T
`Y-17796T
`Y-17329T
`Y-17071T
`Y-27366T
`Y-17645T
`YB-1486T
`YB-3246T
`Y-27120T
`Y-27346T
`YB-1246T
`Y-12697T
`Y-17089T
`Y-17663T
`Y-17090T
`Y-17667T
`Y-7921T
`Y-17761T
`Y-27291T
`Y-17670T
`Y-7791T
`
`CBS
`
`8244
`7376
`227.83
`521.75
`287.82
`530.83
`163.67
`522.75
`10336
`10337
`10338
`6800
`10339
`10340
`7426
`6913
`6826
`8169
`1898
`4878
`7881
`8172
`6064
`8459
`6939
`8798
`8799
`8435
`8402
`8502
`8005
`1010
`8173
`5121
`8183
`6739
`6875
`7955
`5115
`5721
`
`Species
`
`C. vanderwaltii
`C. versatilis
`C. vinaria
`Candida sp. n.
`Candida sp. n.
`Candida sp. n.
`Candida sp. n.
`Candida sp. n.
`Candida sp. n.
`Candida sp. n.
`Candida sp. n.
`Candida sp. n.
`Candida sp. n.
`Candida sp. n.
`Pichia ofunaensis
`P. tannicola
`Sporopachydermia cereana
`Sp. lactativora
`Sp. quercuum
`Stephanoascus ciferrii
`St. farinosus
`St. smithiae
`Sugiyamaella sp. n.
`Sugiyamaella sp. n
`Sympodiomyces attinorum
`Sym. indianaensis
`Sym. parvus
`Trichomonascus petasosporus
`Trigonopsis variabilis
`Trigonopsis sp. n.
`Wickerhamiella australiensis
`W. cacticola
`W. domercqiae
`
`W. lipophila
`W. occidentalis
`Zygoascus hellenicus
`
`Z. meyerae
`Schizosaccharomyces pombe
`
`NRRL
`
`Y-17671T
`Y-6652T
`Y-5715T
`Y-17858T
`Y-27140T
`Y-27117T
`Y-27161T
`YB-1336T
`YB-1473T
`YB-1835T
`YB-1847T
`YB-2263T
`YB-2450T
`YB-3827T
`Y-10998T
`Y-17392T
`Y-7798T
`Y-11591T
`Y-17847T
`Y-10943T
`Y-17593T
`Y-17850I
`YB-2067T
`YB-2798
`Y-27639T
`YB-1950T
`Y-10004T
`YB-2092T
`Y-1579T
`Y-27307T
`Y-27360T
`Y-27362T
`Y-6692T
`Y-6698
`Y-27367T
`Y-27364T
`Y-7136T
`Y-27156
`Y-17319T
`Y-12796T
`
`CBS
`
`5524
`1752
`4077
`7922
`6663
`5924
`7317
`10341
`10342
`10344
`10346
`10348
`10349
`10350
`8129
`6065
`6644
`6192
`8070
`5295
`140.71
`7522.2
`10352
`
`9734
`9600
`6147
`9602
`1040
`10351
`8456
`8454
`4351
`4733
`8458
`8452
`5839
`4028
`4099
`356
`
`NRRL, ARS Culture Collection, National Center for Agricultural Utilization Research, Peoria, IL, USA; CBS, Centraalbureau voor Schimmelcultures,
`Utrecht, The Netherlands; T, type strain; I, isotype strain.
`
`Growth of cultures and DNA isolation
`
`DNA sequencing
`
`Methods for the growth of cultures and extraction of DNA
`have been presented in detail by Kurtzman & Robnett
`(1998). Briefly, cultures were grown for 24–48 h in YM broth
`(Yarrow, 1998a) and harvested by centrifugation. Cells were
`freeze-dried for 1–2 days, and the dried cells were then
`broken by shaking with 0.5-mm glass beads. DNA was
`extracted from the fractured cells using either a sodium
`dodecyl sulfate–phenol/chloroform protocol or through use
`of CTAB/chloroform.
`
`Amplicons of the three genes sequenced were synthesized by
`PCR using the primer pairs and conditions listed below.
`Symmetrical amplification and sequencing reactions were
`conducted using a 96-well plate format. Amplicons were
`purified from PCR reactions using Millipore Multiscreen
`PCR plates (Billerica, MA). Both DNA strands of the genes
`were sequenced with the ABI TaqDyeDeoxy Terminator
`Cycle sequencing kit (Applied Biosystems, Foster City, CA)
`using either ABI 3100 or ABI 3730 automated DNA
`
`c 2006 Federation of European Microbiological Societies
`Published by Blackwell Publishing Ltd. No claim to original US government works
`
`FEMS Yeast Res 7 (2007) 141–151
`
`LCY Biotechnology Holding, Inc.
`Ex. 1025
`Page 2 of 11
`
`

`

`Downloaded from https://academic.oup.com/femsyr/article/7/1/141/492833 by The University of Texas at Austin user on 03 July 2024
`
`Multigene phylogenetic analysis of yeast clades
`
`143
`
`sequencers, following the manufacturers’ instructions. Prior
`to sequencing, DNA fragments from the TaqDyeDeoxy
`sequencing reactions were recovered by precipitating with
`75% ethanol.
`
`Mitochondrial small-subunit rRNA gene
`
`Primers for symmetrical amplification of the gene, and the
`subsequent sequencing reactions,
`included the primers
`given earlier by Kurtzman & Robnett (2003), as well as
`various combinations of the following primers: ARXIOMS-
`0
`-TAATTGTGCCAGCAGTCGCGG), ARXIOMS-2R
`1F (5
`0
`0
`-CGTGCTCCACTACTTAAGTCTG), MS-BLA-1F (5
`-
`(5
`0
`-ATTAAA-
`GGYHTAAAGVRTYAGYAR), MS-BLA-2R (5
`0
`-CBGYC-
`TAACATRMTCCACTG), and MS-BLA-2AR (5
`TAWTGTYTTRRRTTTC). Temperatures for symmetrical
`amplification were denaturation at 96 1C and either 42 1C
`for annealing and 45 1C for extension or 39 1C for annealing
`and 45 1C for extension. For a few of the sequencing
`reactions, 42 1C for annealing and 45 1C for extension were
`used, in contrast to the standard temperatures of 50 1C/
`60 1C.
`
`Cytochrome oxidase II
`
`The various primer combinations used for symmetrical
`amplification and gene sequencing were those reported
`earlier (Kurtzman & Robnett, 2003), as well as the following,
`0
`-
`which were used in various combinations: COII-5C (5
`0
`-GTWTTATW
`GTTCTATATCTTATTAATCG), COII-5E (5
`0
`-SWTATAAATATT-
`TRRTAWTARTAWTATG), COII-5F (5
`0
`-CTTGATTTAATCTACCAG
`TARTWCATGG), COII-3C (5
`0
`-CCACATAWTTCWBDACAYTK
`GATTAGC), COII-3E (5
`0
`-CCTTCWCYTTGWATWAWWGTAC).
`WCC), COII-3F (5
`Temperatures for symmetrical amplification were denatura-
`tion at 96 1C and either 45 1C for annealing and 72 1C for
`extension or 39 1C for annealing and 60 1C for extension.
`For the sequencing reactions, annealing was at 42 1C and
`extension at 45 1C.
`
`Large-subunit rRNA gene
`
`Many of the species in this study had one to six introns of c.
`400–1200 bp inserted in the large-subunit (LSU) rRNA
`gene, often at the conserved, commonly used priming sites.
`The presence of introns increased the length of the LSU gene
`by up to 5.5 kb for some species, and the usual strategy of
`amplifying the LSU in two overlapping halves often failed
`because of the presence of introns in priming sites. Conse-
`quently, the amplicons used for sequencing varied among
`species, but were generated with the primers listed by
`Kurtzman & Robnett (2003), as well as the following, which
`0
`0
`–3
`) across the LSU gene: NL-6F
`are listed sequentially (5
`0
`0
`-CTTGTTACTTAATTGAACGTGGAC), NL-6R
`(5
`-
`(5
`
`0
`
`-CATC-
`GTCCACGTTCAATTAAGTAACAAG), NL-7F (5
`0
`-GACAGCCG-
`TAAACAGCCGGACGGTGGC), NL-7BF (5
`0
`-GTGTAAC
`GACGGTGGCCATGGAAGTCG), NL-7CF (5
`0
`-CATTCGGCC
`AACTCACCGGCCGAATG), NL-7CR (5
`0
`-GCCTCTAGTGCA-
`GGTGAGTTGTTACAC), NL-7DF (5
`0
`-CTACTACCAC-
`GATCTTGGTGGTAGTAG), NL-7DR (5
`0
`-CGCAGCA
`CAAGATCTGCACTAGAGGC), NL-1611BF (5
`0
`-CAGTCA-
`GGTCTCCAAGGTKAACAGC), NL-11AR (5
`0
`-CTGACTGTC-
`GATTCCCCTTGTCCGTAC), NL-11BF (5
`0
`-CTATCTAGCGAA
`TAATTAAAACATAGC), NL-12AF (5
`0
`-GCTGTGGTTTCGCTAGA-
`ACCACAGC), NL-12AR (5
`0
`-CATGAAAGTGTGGCCTATCGATC),
`TAG), NL-15F (5
`0
`-GATCGATAGGCCACACTTTCATG), NL-
`NL-15R
`(5
`0
`-CTAACCTGTCTCACGACGGTC), NL-G19CF
`G19BR (5
`0
`0
`-GCAGTCAAGCGTTCATAGCG), NL-G19DF (5
`-CAG
`(5
`0
`-GAC
`GGATAACTGGCTTGTGGCAGTC), NL-G19DR (5
`0
`-GATA
`TGCCACAAGCCAGTTATCCCTG), NL-G19ER (5
`0
`-GAAAC
`GGAAGAGCCGACATCGAAG), NL-STB1IF (5
`0
`-CTTAAGG-
`TCTGGTGGAGGCTCGTAG), NL-E27AF (5
`0
`-GATGAC-
`TAGCCAAATGCCTCGTCATC), NL-E27AR (5
`0
`-GGATTA
`GAGGCATTTGGCTACCTTAAG), NL-E27BF (5
`0
`-CAGTGGGAAT
`ACGAGATTCCCACTG), NL-E27BR (5
`0
`-CTCATGGAGAACA-
`CTCGTTAATCC), NL-E27DF (5
`0
`-GGAGATTTCTGTTCTC-
`GAAATCTCC), NL-E27DR (5
`0
`-GGCTTAATCTCAGCAGA
`CATGAG), NL-ETS2-1AR (5
`0
`-GATCGTAACAACAAGGCTACT
`TCG), NL-ETS2-GR (5
`0
`-GGATTCTGACTTAG
`CTACTG),
`and NL-ETS2-IR (5
`AGGCGTTCAG). Temperatures for symmetrical amplifica-
`tion were 96 1C for denaturation, 52 1C for annealing, and
`72 1C for extension.
`
`Phylogenetic analysis
`
`Phylogenetic relatedness among taxa was determined from
`the maximum parsimony and neighbor-joining programs of
`
`4.063a (Swofford, 1998). The Kimura-2 parameter
`PAUP
`distance correction was used for neighbor-joining analyses.
`Bootstrap support for all phylogenetic trees was determined
`from 1000 replications. Introns and regions of uncertain
`nucleotide alignment were excluded from phylogenetic
`analysis.
`
`Results and discussion
`
`Phylogenetic analyses
`
`Trees derived from phylogenetic analysis of the LSU rRNA
`gene (Fig. 1), a combined dataset of the mitochondrial
`small-subunit (MtSm) rRNA gene with cytochrome oxidase
`II (COXII) (Fig. 2) and a concatenation of all three gene
`sequences (Fig. 3) illustrate the extent of resolution derived
`from each of these datasets. Both the LSU gene sequence and
`the combined MtSm–COXII sequences provided similar
`resolution of taxa, with some basal
`lineages ending in
`
`FEMS Yeast Res 7 (2007) 141–151
`
`c 2006 Federation of European Microbiological Societies
`Published by Blackwell Publishing Ltd. No claim to original US government works
`
`LCY Biotechnology Holding, Inc.
`Ex. 1025
`Page 3 of 11
`
`

`

`144
`
`C.P. Kurtzman & C.J. Robnett
`
`Downloaded from https://academic.oup.com/femsyr/article/7/1/141/492833 by The University of Texas at Austin user on 03 July 2024
`
`Fig. 1. Bootstrap consensus tree of species in the Trichomonascus–Wickerhamiella–Zygoascus species complex from maximum parsimony analysis of
`26S rRNA genes, which gave 12 most parsimonious trees. Bootstrap values Z50% are given at branch nodes based on 1000 replications. Tree
`length = 3936, consistency index (CI) = 0.417,
`retention index (RI) = 0.718,
`rescaled consistency index (RC) = 0.300, parsimony-informative
`characters = 818. Schizosaccharomyces pombe was the designated outgroup species for the analysis. Abbreviations for all figures: A., Arxula; Bla.,
`Blastobotrys; Bot., Botryozyma; C., Candida; P., Pichia; Schiz., Schizosaccharomyces; Sp., Sporopachydermia; St., Stephanoascus; Sym., Sympodio-
`myces; Trich., Trichomonascus; Trig., Trigonopsis; W., Wickerhamiella; Z., Zygoascus; T, type strain; I, isotype strain. GenBank accession numbers follow
`strain designations.
`
`c 2006 Federation of European Microbiological Societies
`Published by Blackwell Publishing Ltd. No claim to original US government works
`
`FEMS Yeast Res 7 (2007) 141–151
`
`LCY Biotechnology Holding, Inc.
`Ex. 1025
`Page 4 of 11
`
`

`

`Multigene phylogenetic analysis of yeast clades
`
`145
`
`Downloaded from https://academic.oup.com/femsyr/article/7/1/141/492833 by The University of Texas at Austin user on 03 July 2024
`
`Fig. 2. Bootstrap consensus tree of species in the the Trichomonascus, Wickerhamiella and Zygoascus species complex from maximum parsimony
`analysis of combined sequences from MtSm and COXII. The analysis gave two most parsimonious trees. Tree length = 4553, consistency index
`(CI) = 0.302, retention index (RI) = 0.698, rescaled consistency index (RC) = 0.211, parsimony-informative characters = 681. Schizosaccharomyces
`pombe was the outgroup species in the analysis, and bootstrap values Z50% are given at branch nodes based on 1000 replications. For each species,
`GenBank accession numbers follow strain numbers, with MtSm preceding COXII.
`
`FEMS Yeast Res 7 (2007) 141–151
`
`c 2006 Federation of European Microbiological Societies
`Published by Blackwell Publishing Ltd. No claim to original US government works
`
`LCY Biotechnology Holding, Inc.
`Ex. 1025
`Page 5 of 11
`
`

`

`146
`
`C.P. Kurtzman & C.J. Robnett
`
`Downloaded from https://academic.oup.com/femsyr/article/7/1/141/492833 by The University of Texas at Austin user on 03 July 2024
`
`Fig. 3. Phylogenetic tree of the Trichomonascus–Wickerhamiella–Zygoascus species complex represented by one of two most parsimonious trees
`derived from maximum parsimony analysis of combined sequences of LSU, MtSm and COXII. Tree length = 8633, consistency index (CI) = 0.349,
`retention index (RI) = 0.699, rescaled consistency index (RC) = 0.244, parsimony-informative characters = 1499. Bootstrap values of Z50% are given at
`nodes based on 1000 replications. Schizosaccharomyces pombe served as the outgroup species.
`
`c 2006 Federation of European Microbiological Societies
`Published by Blackwell Publishing Ltd. No claim to original US government works
`
`FEMS Yeast Res 7 (2007) 141–151
`
`LCY Biotechnology Holding, Inc.
`Ex. 1025
`Page 6 of 11
`
`

`

`Downloaded from https://academic.oup.com/femsyr/article/7/1/141/492833 by The University of Texas at Austin user on 03 July 2024
`
`Multigene phylogenetic analysis of yeast clades
`
`147
`
`polytomies. Trees from MtSm and COXII, when analyzed
`separately, were nearly identical. When MtSm and COXII
`were combined, bootstrap support
`for deeper lineages
`increased only slightly, but no conflicts were apparent. The
`greatest bootstrap support of basal lineages resulted from
`analysis of a concatenated dataset of all three gene se-
`quences.
`Species relationships on well-supported branches were
`congruent for all three gene trees. Trees derived from
`maximum parsimony analysis were essentially identical to
`trees derived from neighbor-joining analysis with the Ki-
`mura 2-parameter distance correction, but bootstrap sup-
`port from neighbor-joining trees was generally greater. The
`only conflict detected among gene trees was that of bootstrap
`support for the Stephanoascus smithiae clade. LSU analysis
`gave relatively weak support, with members of
`this
`group separated into three subclades. From combined
`MtSm–COXII analysis, the clade showed 100% bootstrap
`support. Concatenation of the three genes gave less than 50%
`support to the clade when analyzed by maximum parsimony
`and 56% from neighbor-joining. When the dataset included
`only the Stephanoascus smithiae and Trichomonascus clades,
`bootstrap support
`for the Stephanoascus smithiae clade
`increased to 75% following maximum parsimony analysis.
`The results were the same whether the outgroup selected was
`Schizosaccharomyces pombe or Zygoascus hellenicus, which is
`more closely related to the ingroup.
`The preceding analyses have demonstrated taxonomic
`heterogeneity among several of the phylogenetically defined
`clades. Most notable is the Trichomonascus clade, which
`contains two species of Stephanoascus as well as species from
`the anamorphic genera Arxula, Blastobotrys, Candida and
`Sympodiomyces. Each of these clades will be discussed with
`proposals for reconciling species classification with phylo-
`genetic circumscription.
`
`Sporopachydermia clade
`
`The three species assigned to Sporopachydermia represent a
`small, strongly supported clade that is basal to the other
`ascosporic clades included in this analysis.
`
`Zygoascus clade
`
`The two species presently assigned to Zygoascus, which are
`heterothallic and have only been isolated as haploid mating
`types, are quite closely related, as was demonstrated from
`comparisons of nuclear DNA reassociation (Smith et al.,
`2005). Each of the species has two subpopulations, with the
`subpopulations for each species showing c. 70% nuclear
`DNA relatedness. Subpopulations of Z. hellenicus were
`accorded the anamorphic names Candida steatolytica var.
`steatolytica and C. steatolytica var.
`inositophila, whereas
`subpopulations of Z. meyerae were named C. hellenica var.
`
`hellenica and C. hellenica var. acidophila. The two strains of
`Z. hellenicus included in the present study represent var.
`steatolytica and showed no nucleotide differences in D1/D2,
`MtSm or COXII. The earlier demonstration from D1/D2
`LSU analysis (Kurtzman & Robnett, 1998), showing that
`Pichia ofunaensis and P. tannicola are members of the
`Zygoascus clade, has been confirmed in the present analysis.
`For this reason, it is proposed that these two species be
`transferred to the genus Zygoascus as the following new
`combinations.
`(1) Zygoascus ofunaensis (Makiguchi & Y. Asai) Kurtzman &
`Robnett comb. nov. Basionym: Hansenula ofunaensis Maki-
`guchi & Y. Asai. J Gen Appl Microbiol 22, 200, 1976.
`Synonym: Pichia ofunaensis (Makiguchi & Y. Asai) Kurtz-
`man (1996).
`(2) Zygoascus tannicolus (F.H. Jacob) Kurtzman & Robnett
`comb. nov. Basionym: Pichia tannicola F.H. Jacob. Bull Soc
`Mycol France 85, 111, 1969. Synonym: Pichia abadieae F.H.
`Jacob (1969).
`With the assignment of the preceding two species to
`Zygoascus, the genus description requires emendation. Zy-
`goascus M. Th. Smith emend. Kurtzman & Robnett: Asci
`may be free, and conjugated or unconjugated, or formed on
`hyphae following conjugation of opposite mating types. Asci
`may be persistent or deliquescent, and form one to four
`hemispheroidal, subspherical or hat-shaped ascospores.
`Asexual reproduction is by multilateral budding and forma-
`tion of pseudohyphae. True hyphae may also be formed and
`may produce blastoconidia. Sugars are fermented and
`nitrate is assimilated by some species.
`
`Sugiyamaella clade
`
`Stephanoascus smithiae and related species form a clade that
`is phylogenetically well separated from Stephanoascus cifer-
`rii, the type species of Stephanoascus, as well as from
`Stephanoascus farinosus. Other members of the clade include
`12 species of Candida as well as three undescribed ascosporic
`species. Bootstrap support for this clade is 100% from
`combined MtSm–COXII sequence analysis, but under 50%
`from LSU analysis. Nonetheless, there is no conflict between
`the two datasets for placement of well-supported species,
`suggesting that this clade represents a natural group. As will
`be discussed below, the genus name Stephanoascus is now a
`synonym of Trichomonascus, and a new genus is proposed
`for Stephanoascus smithiae (designated type species) and
`related ascosporic species.
`
`Sugiyamaella Kurtzman & Robnett gen. nov.
`
`Asci globosae vel ellipsoidae cum cellula apicali aut tuber-
`culo, singuli, persistentes vel deliquenscentes tarde, uni- ad
`quadrispori, exorientes hyphae copulantibus. Ascosporae
`
`FEMS Yeast Res 7 (2007) 141–151
`
`c 2006 Federation of European Microbiological Societies
`Published by Blackwell Publishing Ltd. No claim to original US government works
`
`LCY Biotechnology Holding, Inc.
`Ex. 1025
`Page 7 of 11
`
`

`

`Downloaded from https://academic.oup.com/femsyr/article/7/1/141/492833 by The University of Texas at Austin user on 03 July 2024
`
`148
`
`C.P. Kurtzman & C.J. Robnett
`
`semiglobosae, ellipsoidae, petasiformes aut bacilliformis. Cel-
`lulae vegetativae globosae aut elongatae, gemmatione multi-
`laterali propagantes; blastoconidia e cellulis conidiogenis
`denticulatis oriuntur. Pseudohyphae et hyphae septatae fiunt.
`Sacchara fermentantur aut non fermentantur. Saccharas
`assimilantur; amylum solubile assimilatur raro. Genus novum
`a generaibus aliis sequentibus nucleotiditis 26S rRNA gene,
`mitochondrial submonas parvus rRNA gene et cytochrome
`oxidase II gene distinguenda. Species typica Sugiyamaella
`smithiae (Gim´enez-Jurado) Kurtzman & Robnett comb. nov.
`
`Description of Sugiyamaella Kurtzman & Robnett
`gen. nov.
`
`Asci are globose to ellipsoidal with an apical cell or with a
`short protuberance. Asci arise singly on hyphae of diploid
`strains or following conjugation of complementary mating
`types. Asci form one to four ascospores, and ascus walls are
`usually persistent, but may deliquesce slowly. Ascospores are
`hemispherical, forming a hat-like shape, somewhat ellipsoi-
`dal or rod-shaped. Cell division is by multilateral budding
`and through blastoconidium formation, often on denticulate
`conidiogenous cells. Pseudohyphae and true hyphae are
`commonly formed. Sugars may or may not be fermented. A
`variety of sugars and other carbon sources are assimilated,
`but soluble starch is rarely utilized. Although a key to genera
`is provided, the most reliable means for recognizing species
`assigned to Sugiyamaella is from gene sequence comparisons.
`Etymology: The genus Sugiyamaella is named in honor of
`Dr Junta Sugiyama, Professor, University of Tokyo, Japan,
`for his outstanding research in mycology, which has ranged
`from conventional studies to molecular phylogeny.
`(1) Sugiyamaella smithiae (Gim´enez-Jurado) Kurtzman &
`Robnett comb. nov. Basionym: Stephanoascus
`smithiae
`Gim´enez-Jurado. Syst Appl Microbiol 17, 240, 1994. Syno-
`nym and anamorphic state: Candida edax van der Walt &
`Nel (1968).
`The remaining three ascosporic species in the Sugiya-
`maella clade, which are represented by NRRL YB-2067,
`NRRL YB-2798 and NRRL Y-17643, will be described in a
`publication now in preparation, along with the presently
`undescribed Candida species included in this clade.
`
`Wickerhamiella clade
`
`The type species of Wickerhamiella, W. domercqiae, and the
`anamorphic species Candida versatilis, represent members
`of a subclade that is basal to more recently described species
`of the genus (Lachance et al., 1998, 2000). The extent of
`divergence between members of the two subclades is similar
`to the divergence seen between subclades of the genus
`Hanseniaspora (Kurtzman & Robnett, 2003). Discovery of
`additional species in both Wickerhamiella and Hansenia-
`
`spora will help determine if each represents a single genus
`or two closely related genera. Divergence between NRRL
`Y-6692 and NRRL Y-6698,
`the two known strains of
`W. domercqiae, is approaching that of independent species.
`
`Trichomonascus clade
`
`The Trichomonascus clade (Fig. 3) is well supported from
`multigene sequence analysis (100%). This clade includes the
`ascosporic genera Trichomonascus and Stephanoascus, as well
`as species from the anamorphic genera Arxula, Blastobotrys,
`Candida and Sympodiomyces. The various genera were
`originally described from what appeared to be unique
`morphology. Asci of Trichomonascus form terminally on
`hyphae, with ascospore formation initiated after a tricho-
`gyne-like hypha, which arises from the hyphal cell support-
`ing the ascus, extends and fuses with the terminus of the
`ascus. Asci of Stephanoascus usually arise directly from
`hyphae and are globose with a small, sterile apical cell
`(Smith & de Hoog, 1998). The close relatedness of these
`two genera was only recognized from D1/D2 sequence
`analysis of the recently described Trichomonascus petaso-
`sporus (Kurtzman, 2004).
`The dimorphic, asexual genus Blastobotrys was originally
`described as a hyphomycete, but it was placed in the
`Saccharomycetales following analysis of D1/D2 sequences
`(Kurtzman & Robnett, 1995). The close relatedness of
`Blastobotrys with Arxula, Sympodiomyces and several Candi-
`da species was recognized from D1/D2 sequence analysis,
`but resolution from this partial gene sequence was insuffi-
`cient to determine whether the genera were phylogenetically
`distinct. Data from the present study show that the three
`genera, along with several species of Candida, represent
`members of the same clade. Earlier described Blastobotrys
`species form a subclade with Stephanoascus farinosus. Some
`of the Blastobotrys species, such as Bla. aristata and Bla.
`capitulata, form blastoconidia with elongated setae, giving
`cells the appearance of long, slender spermatozoa (de Hoog
`& Smith, 1998). These cells are not produced by all members
`of the subclade, but they are found in cultures of Candida
`mokoenaii and Blastobotrys sp. n. NRRL YB-1343, which
`occur in an adjacent subclade.
`The genus Sympodiomyces, in contrast to Blastobotrys, was
`initially recognized as a yeast (Fell & Statzell, 1971). The
`three known species form true hyphae that give rise to
`sympodially formed clusters of blastoconidia, which arise on
`denticles similar to those formed by Blastobotrys. LSU,
`MtSm and COXII sequences were not determined in the
`present study for the recently described Sympodiomyces
`attinorum (Carreiro et al., 2004), but
`the D1/D2 tree
`included with the description places Sympodiomyces attinor-
`um as a sister to Sympodiomyces parvus. The two described
`species of Arxula, which occur in separate subclades of the
`
`c 2006 Federation of European Microbiological Societies
`Published by Blackwell Publishing Ltd. No claim to original US government works
`
`FEMS Yeast Res 7 (2007) 141–151
`
`LCY Biotechnology Holding, Inc.
`Ex. 1025
`Page 8 of 11
`
`

`

`Downloaded from https://academic.oup.com/femsyr/article/7/1/141/492833 by The University of Texas at Austin user on 03 July 2024
`
`Multigene phylogenetic analysis of yeast clades
`
`149
`
`phylogenetic tree (Fig. 3), also form blastoconidia on
`denticles, but with less clustering than seen in the previous
`two genera (Smith, 1998). Blastoconidium formation by
`Candida chiropterorum and C. mokoenaii is similar to what
`is seen in the preceding species, but not as pronounced as in
`Blastobotrys. Consequently,
`it appears that one of
`the
`primary reasons for placement of the preceding species in
`four separate anamorphic genera resides in the perceived
`subtleties of blastoconidium formation. Interestingly, de-
`spite the variation in ascus formation and blastoconidio-
`phore development shown by the preceding species, the
`clade appears to be physiologically different from other
`yeasts, because all species tested grow on most of the
`compounds in a panel composed of hexadecane, glycine,
`uric acid, adenine, isobutanol, leucine, isoleucine and pu-
`trescine (Middelhoven & Kurtzman, 2003).
`From our gene sequence analyses, the Trichomonascus
`clade is a single, phylogenetically circumscribed taxonomic
`group that can be represented by a single ascosporic genus
`and a single anamorphic genus. Of the two ascosporic genera
`in this clade, Trichomonascus was described in 1947 (Jackson,
`1947) and has taxonomic priority over Stephanoascus, which
`was described in 1976 with Stephanoascus ciferrii as the type
`species (Smith et al., 1976). The anamorphic states of this
`clade are characterized by noticeably denticulate conidio-
`phores, and the species assimilate a number of unusual
`compounds, which phenotypically separates them from
`typical species of the anamorphic genus Candida. The genus
`Blastobotrys, type species Bla. nivea, was described in 1967
`(von Klopotek, 1967) and has taxonomic priority over
`Sympodiomyces, type species Sympodiomyces parvus (Fell &
`Statzell, 1971) and Arxula, type species A. terrestris (van der
`Walt et al., 1990). On the basis of taxonomic priorities, the
`following new combinations are proposed for Trichomonas-
`cus and its anamorphic genus Blastobotrys.
`(1) Trichomonascus ciferrii (M. Th. Smith, van der Walt &
`E. Johannsen) Kurtzman & Robnett comb. nov. Basionym:
`Stephanoascus ciferrii M. Th. Smith, van der Walt & E.
`Johannsen. Antonie van Leeuwenhoek 42, 125, 1976. Syno-
`nyms: Candida ciferrii Kreger-van Rij (1965), Sporothrix
`catenata de Hoog & Constantinescu (1981), Candida muci-
`fera Kockov´a-Kratochv´ılov´a & Sl´avikov´a (1988).
`(2) Trichomonascus farinosus (de Hoog, Rantio-Lehtim¨aki
`& M. Th. Smith) Kurtzman & Robnett comb. nov. Basio-
`nym: Stephanoascus farinosus de Hoog, Rantio-Lehtim¨aki &
`M. Th. Smith. Antonie van Leeuwenhoek 51, 102, 1985.
`Synonym: Blastobotrys farinosus de Hoog, Rantio-Lehtim¨aki
`& M. Th. Smith (1985).
`(3) Blastobotrys adeninivorans (Middelhoven, Hoogkamer-
`Te Niet & Kreger-van Rij) Kurtzman & Robnett comb. nov.
`Basionym: Trichosporon adeninovorans Middelhoven, Hoog-
`kamer-Te Niet & Kreger-van Rij. Antonie van Leeuwenhoek
`50, 373, 1984. Synonym: Arxula adeninovorans (Middelho-
`
`ven, Hoogkamer-Te Niet & Kreger-van Rij) van der Walt,
`M. Th. Smith & Y. Yamada (1990).
`(4) Blastobotrys attinorum (Carreiro, Pagnocca, Bacci, La-
`chance, Bueno, Hebling, Ruivo & Rosa) Kurtzman &
`Robnett comb. nov. Basionym: Sympodiomyces attinorum
`Carreiro, Pagnocca, Bacci, Lachance, Bueno, Hebling, Ruivo
`& Rosa. Int J Syst Evol Microbiol 54, 1893, 2004.
`(5) Blastobotrys chiropterorum (Grose & Marinkelle) Kurtz-
`man & Robnett comb. nov. Basionym: Candida chiropteror-
`um Grose & Marinkelle. Mycopath Mycol Appl 36, 227, 1968.
`(6) Blastobotrys indianaensis (Kurtzman) Kurtzman & Rob-
`nett comb. nov. Basionym: Sympodiomyces indianaensis
`Kurtzman. Antonie van Leeuwenhoek 85, 302, 2004.
`(7) Blastobotrys mokoenaii (Mokwena, Jansen van Rensburg
`& Myburgh) Kurtzman & Robnett comb. nov. Basionym:
`Candida mokoenaii Mokwena, Jansen van Rensburg &
`Myburgh. Antonie van Leeuwenhoek 77, 44, 2000.
`(8) Blastobotrys parvus (Fell & Statzell) Kurtzman & Rob-
`nett comb. nov. Basionym: Sympodiomyces parvus Fell &
`Statzell. Antonie van Leeuwenhoek 37,