APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Dec. 2008, p. 7779–7789
`0099-2240/08/$08.00⫹0 doi:10.1128/AEM.01412-08
`Copyright © 2008, American Society for Microbiology. All Rights Reserved.
`
`Vol. 74, No. 24
`
`Control of Lipid Accumulation in the Yeast Yarrowia lipolytica䌤
`Athanasios Beopoulos,1,2,3 Zuzana Mrozova,1,2,4 France Thevenieau,1† Marie-The´re`se Le Dall,1
`Ivan Hapala,4 Seraphim Papanikolaou,3 Thierry Chardot,2 and Jean-Marc Nicaud1*
`Laboratoire de Microbiologie et Ge´ne´tique Mole´culaire, INRA, UMR1238, CNRS, UMR2585, AgroParisTech, Centre de Biotechnologie Agro-
`Industrielle, BP 01, 78850 Thiverval-Grignon, France1; Laboratoire de Chimie Biologique, INRA, UMR206, AgroParisTech,
`Centre de Biotechnologie Agro-Industrielle, 78850 Thiverval-Grignon, France2; Laboratory of Food Microbiology and
`Biotechnology, Department of Food Science and Technology, Iera Odos 75, 11855 Athens, Greece3; and Institute of
`Animal Biochemistry andproc Genetics, Slovak Academy of Sciences, Moyzesova 61,
`Ivanka pri Dunaji 900 28, Slovakia4
`
`Received 24 June 2008/Accepted 17 October 2008
`
`A genomic comparison of Yarrowia lipolytica and Saccharomyces cerevisiae indicates that the metabolism of Y.
`lipolytica is oriented toward the glycerol pathway. To redirect carbon flux toward lipid synthesis, the GUT2
`gene, which codes for the glycerol-3-phosphate dehydrogenase isomer, was deleted in Y. lipolytica in this study.
`This ⌬gut2 mutant strain demonstrated a threefold increase in lipid accumulation compared to the wild-type
`strain. However, mobilization of lipid reserves occurred after the exit from the exponential phase due to
`␤-oxidation. Y. lipolytica contains six acyl-coenzyme A oxidases (Aox), encoded by the POX1 to POX6 genes, that
`catalyze the limiting step of peroxisomal ␤-oxidation. Additional deletion of the POX1 to POX6 genes in the
`⌬gut2 strain led to a fourfold increase in lipid content. The lipid composition of all of the strains tested
`demonstrated high proportions of FFA. The size and number of the lipid bodies in these strains were shown
`to be dependent on the lipid composition and accumulation ratio.
`
`The oleaginous yeast Yarrowia lipolytica is one of the most
`extensively studied “nonconventional” yeasts. This yeast is able
`to accumulate large amounts of lipids (in some cases, more
`than 50% of its dry weight [DW]) (26). Several technologies
`including different fermentation configurations have been ap-
`plied for single-cell oil production by strains of Y. lipolytica
`grown on various agro-industrial by-products or wastes (i.e.,
`industrial fats, crude glycerol, etc.) (10, 23). Potential applica-
`tions of these processes are targeting the production of reserve
`lipids with a specific structure and/or composition. These in-
`clude (i) oils enriched in essential polyunsaturated FA as po-
`tential nutritional complements, (ii) lipids showing composi-
`tion similarities to cocoa butter, and (iii) nonspecific oils
`destined for use as renewable starting materials for the syn-
`thesis of biofuels. Accordingly, increased research interest has
`focused on genetic and metabolic engineering approaches to
`“construct” yeast strains to be used as cell factories for storing
`and producing huge amounts of oil with an attractive FA com-
`position (10).
`Y. lipolytica is able to utilize hydrophobic substrates (e.g.,
`alkanes, FA, and oils) efficiently as a sole carbon source (5, 10).
`Its superior capacity to accumulate lipids when grown on these
`substrates is probably related to protrusions formed on cell
`surfaces, facilitating the uptake of hydrophobic substrates from
`the medium (21). Internalized aliphatic chains can be either
`
`* Corresponding author. Mailing address: Laboratoire de Microbi-
`ologie et Ge´ne´tique Mole´culaire, AgroParisTech, Centre de Biotech-
`nologie Agro-Industrielle, INRA Centre de Grignon, BP 01, 78850
`Thiverval-Grignon, France. Phone: 33 01 30 81 54 50. Fax: 33 01 30 81
`54 57. E-mail: jean-marc.nicaud@grignon.inra.fr.
`† Present address: Oxyrane UK Ltd., Greenheys House, Manchester
`Science Park, 10 Pencroft Way, Manchester M15 6JJ, United King-
`dom.
`䌤 Published ahead of print on 24 October 2008.
`
`degraded for growth requirements or accumulated in an un-
`changed or a modified form (10). Storage molecules such as
`triglycerides (TAG) and steryl esters (SE) are not suitable for
`integration into phospholipid bilayers. Therefore, they cluster
`to form the hydrophobic core of so-called lipid bodies (LB).
`Originally, LB were considered only as a depot of neutral lipids
`which can be mobilized under starving conditions. However,
`the view of the LB as a simple storage compartment, excluded
`from any metabolic process, had to be revised since many of its
`proteins were identified as enzymes involved in lipid metabo-
`lism, especially in TAG synthesis and degradation. Recently, a
`lipid binding protein identified in Y. lipolytica LB (2, 9) was
`shown to be involved in lipid trafficking between cytoplasm and
`LB. This indicates that LB are probably capable of accommo-
`dating free FA (FFA) as well (2, 6, 21, 23).
`In yeasts, TAG synthesis follows the Kennedy pathway (15).
`FFA are activated to coenzyme A (CoA) and used for the
`acylation of the glycerol backbone to synthesize TAG. In the
`first step of TAG assembly, glycerol-3-phosphate (G3P) is acyl-
`ated by G3P acyltransferase (SCT1) to lysophosphatidic acid
`(LPA), which is then further acylated by LPA acyltransferase
`(SLC1) to phosphatidic acid (PA). This is followed by dephos-
`phorylation of PA by PA phosphohydrolase (PAP) to release
`diacylglycerol (DAG). In the final step, DAG is acylated either
`by DAG acyltransferase (DGA1 with acyl-CoA as an acyl do-
`nor) or by phospholipid DAG acyltransferase (LRO1 with glyc-
`erophospholipids as an acyl donor) to produce TAG (Fig. 1
`and Table 1) (8, 28).
`Degradation of FA in yeasts occurs via the ␤-oxidation path-
`way, a multistep process requiring four different enzymatic
`activities. Enzyme localization is restricted to peroxisomes in
`yeasts, whereas in mammals these reactions are located in both
`mitochondria and peroxisomes. Mobilization of accumulated
`lipids occurs as a consequence of three different metabolic
`
`7779
`
`LCY Biotechnology Holding, Inc.
`Ex. 1034
`Page 1 of 11
`
`

`

`7780
`
`BEOPOULOS ET AL.
`
`APPL. ENVIRON. MICROBIOL.
`
`FIG. 1. Overview of different pathways involved in FA synthesis and storage and degradation of neutral lipids. Synthesis of FA (Acyl-CoA) is
`catalyzed by the FA synthesis complex from the basic blocks acetyl-CoA and malonyl-CoA. Acyl-CoA can be stored either as SE or as TAG. The
`synthesis of SE is catalyzed by SE synthases homologous to the human acyl-CoA:cholesterol acyltransferase and their mobilization by the SE
`hydrolases, releasing sterol and FFA. The synthesis of TAG require acyl-CoA and G3P. G3P could be produced from glycerol or from DHAP.
`GUT1 encodes a glycerol kinase that converts glycerol to G3P in the cytosol. The product of this reaction can be oxidized to DHAP by the G3PDH
`encoded by the GUT2 gene. DHAP can enter either glycolysis or gluconeogenesis. G3P could also be used as a skeleton for TAG synthesis. Three
`acyls are added to the G3P backbone to give TAG, and this process requires four enzymatic steps. First, an acyl is added at the sn-1 position of
`G3P by a G3P acyltransferase to produce LPA, and then a second acyl is added at the sn-2 position by a 1-acyl G3P acyltransferase to produce
`PA, which is then dephosphorylated by PAP, yielding DAG. Finally, the third acyl can be added at the sn-3 position either by the acetyl-CoA-
`dependent pathway (directly from acyl-CoA) or by the acetyl-CoA-independent pathway (from a glycerophospholipid). TAG can be mobilized by
`the conversion to FFA and DAG upon hydrolysis by TAG lipase. The FFA can then be degraded in the ␤-oxidation pathway. This pathway requires
`four enzymatic steps (for a review, see reference 11). In Y. lipolytica, six genes (POX1 to POX6) that code for acyl-CoA oxidases are involved in
`the second step of ␤-oxidation (11, 29). Proteins encoded by the genes in parentheses were found to be associated with lipid particles (LB) in Y.
`lipolytica.
`
`states, (i) during the exponential phase of growth, when stor-
`age lipids are used for membrane lipid synthesis to support
`cellular growth and division, (ii) during stationary phase, when,
`upon nutrient depletion, FFA are liberated rather slowly from
`the TAG and subjected to peroxisomal ␤-oxidation, and (iii)
`when cells exit starvation conditions, e.g., from stationary
`phase, and enter a vegetative growth cycle, and upon carbon
`supplementation, lipid depots are very rapidly degraded to
`FFA (17).
`In this study, we focused on the importance of G3P in TAG
`formation. Localized in LB (2), it is suspected of playing a
`crucial role in TAG metabolism (16, 22, 28). There are two
`different routes to G3P synthesis. In one, G3P is derived from
`glycerol via glycerol kinase (GUT1). In the second, G3P is
`directly
`synthesized
`from dihydroxyacetone
`phosphate
`(DHAP) catalyzed by G3P dehydrogenase (GPD1). This last
`reaction is reversible, and the DHAP formation from G3P is
`catalyzed by a second G3P dehydrogenase (G3PDH) isoform
`encoded by GUT2. In order to stimulate the TAG biosynthetic
`pathway and increase lipid accumulation in Y. lipolytica, we
`deleted the GUT2 gene that encodes the G3PDH isoform and
`showed that its deficiency leads to a strong boost in the final
`lipid content of this yeast. To further increase lipid content, we
`prevented the yeast from degrading its lipid stores by abolish-
`ing the ␤-oxidation pathway. This modification was attained by
`
`deleting the POX genes that encode the acyl-coenzyme oxi-
`dases (Aox), a family of six peroxisomal acyl-coenzyme oxi-
`dases encoded by the POX1 to POX6 genes in Y. lipolytica (10,
`29). We demonstrate here that combination of GUT2 and POX
`deficiencies, together with modification of the composition of
`the growth medium, leads to an altered composition of lipid
`species and a change in the accumulation ratio of lipids stored
`in the yeast Y. lipolytica.
`
`MATERIALS AND METHODS
`
`Yeast strains, growth, and culture conditions. The Y. lipolytica strains used in
`this study were derived from wild-type (WT) strain Y. lipolytica W29 (ATCC
`20460) (Table 2 and Fig. 2). Auxotrophic strain Po1d (Leu⫺ Ura⫺) was described
`previously by Barth and Gaillardin (5). Prototrophic strain MTLY37, in which
`four POX genes that code for acyl-CoA oxidases (Aox) were inactivated, was
`described by Wang et al. (29). The auxotrophic derivative MTLY40 (Ura⫺) was
`obtained by transformation of MTLY37 by using a 1.5-kb PCR fragment carrying
`the ura3-41 allele, followed by selection of transformants on YNB-5FOA me-
`dium (21). The strains with deletions of the GUT2 gene, which codes for
`G3PDH, and the remaining POX genes are indicated in Table 2, and a schematic
`presentation of their construction is depicted in Fig. 2. Details of their construc-
`tion are presented below.
`Media and growth conditions for Escherichia coli were described by Sambrook
`et al. (27), and those for Y. lipolytica were described by Barth and Gaillardin (5).
`Rich medium (YPD), minimal glucose medium (YNB), and minimal medium
`with Casamino Acids (YNBcas) were prepared as described previously (21).
`Minimal medium (YNB) contained 0.17% (wt/vol) yeast nitrogen base (without
`
`LCY Biotechnology Holding, Inc.
`Ex. 1034
`Page 2 of 11
`
`

`

`VOL. 74, 2008
`
`LIPID ACCUMULATION IN YARROWIA LIPOLYTICA
`
`7781
`
`TABLE 1. Genes involved in FA metabolism in Y. lipolytica and S. cerevisiaea
`
`Gene
`
`S. cerevisiae name
`
`EC no.
`
`Y. lipolytica ortholog
`
`% Amino acid
`identityb
`(% gap)
`
`Function
`
`GUT1
`GPD1
`GPD2
`GUT2
`SCT1
`GPT2
`SLC1
`DGA1
`LRO1
`TGL3
`TGL4
`TGL5
`ARE1
`ARE2
`TGL1
`POX1
`POX2
`POX3
`POX4
`POX5
`POX6
`MFE1
`POT1
`
`YHL032c
`YDL022w
`YDL059w
`YIL155c
`YBL011w
`YKR067w
`YDL052c
`YOR245c
`YNR008w
`YMR313c
`YKR089c
`YOR081c
`YCR048w
`YNR019w
`YKL140w
`YGL205w
`
`EC 2.7.1.30
`EC 1.1.1.18
`EC 1.1.1.18
`EC 1.1.99.5
`EC 2.3.1.15
`EC 2.3.1.15
`EC 2.3.1.51
`EC 2.3.1.20
`EC 2.3.1.158
`EC 3.1.1.3
`EC 3.1.1.3
`EC 3.1.1.3
`EC 2.3.1.26
`EC 2.3.1.26
`EC 3.1.1.13
`EC 6.2.1.3
`
`YKR009c
`YIL160c
`
`EC 4.2.1.74
`EC 2.3.1.16
`
`YALI0F00484g
`YALI0B02948g
`
`YALI0B13970g
`YALI0C00209g
`
`YALI0E18964g
`YALI0E32769g
`YALI0E16797g
`YALI0D17534g
`YALI0F10010g
`
`YALI0F06578g
`
`YALI0E32035g
`YALI0E32835g
`YALI0F10857g
`YALI0D24750g
`YALI0E27654g
`YALI0C23859g
`YALI0E06567g
`YALI0E15378g
`YALI0E18568g
`
`35 (29)
`52 (11)
`61 (11)
`44 (11)
`40 (7)
`28 (7)
`33 (23)
`33 (27)
`45 (4)
`21 (13)
`29 (13)
`29 (13)
`30 (7)
`33 (7)
`32 (11)
`35 (10)
`35 (8)
`35 (9)
`33 (0)
`35 (0)
`35 (2)
`49 (5)
`55 (4)
`
`Glycerol kinase
`G3P dehydrogenase (NAD⫹)
`G3P dehydrogenase (NAD⫹)
`G3P dehydrogenase
`G3P acyltransferase
`G3P acyltransferase
`1-Acyl-sn-G3P acyltransferase
`DAG acyltransferased
`Phospholipid:DAG acyltransferased
`Triacylglycerol lipase
`Triacylglycerol lipase
`Triacylglycerol lipase
`Acyl-CoA:sterol acyltransferasec
`Acyl-CoA:sterol acyltransferase
`Cholesterol esterase
`Acyl-CoA oxidasec
`Acyl-CoA oxidased
`Acyl-CoA oxidased
`Acyl-CoA oxidasec
`Acyl-CoA oxidasec
`Acyl-CoA oxidasec
`Multifunctional ␤-oxidation proteinc
`Peroxisomal oxoacyl thiolasec
`
`a Shown are genes, corresponding S. cerevisiae gene names and EC (Enzyme Commission) numbers, Y. lipolytica orthologs (gene name), and corresponding functions.
`Bioinformatic data were obtained from the Saccharomyces Genome Database (http://www.yeastgenome.org/) and the Genolevures database (http://cbi.labri.fr
`/Genolevures/).
`b The comparative analysis was based on pairwise alignments of the full protein sequence predicted by the ClustalX program (http://bips.u-strasbg.fr/fr
`/Documentation/ClustalX/), and sequence identity or similarity was determined on the basis of this full alignment with Genedoc (http://www.nrbsc.org/gfx/genedoc/).
`ID, identity. % gap, percentage of residues unaligned within gaps.
`c Confirmed by functional analysis.
`d Confirmed by protein characterization.
`
`amino acids and ammonium sulfate, YNBww; Difco, Paris, France), 0.5% (wt/
`vol) NH4Cl, 0.1% (wt/vol) yeast extract (Bacto-DB), and 50 mM phosphate
`buffer (pH 6.8). Glucose medium YNBD (2%, wt/vol; Merck, Fontenay-sous-
`Bois Cedex, France) was supplemented with oleic acid from Merck (60% purity),
`and glycerol medium YNBG (2%, wt/vol; Merck) and oleic acid media YNBDO
`and YNBOup and were supplemented with oleic acid from Fluka (98% purity).
`Uracil (0.1 g/liter) and leucine (0.2 g/liter) were added when required. For solid
`media, 1.5% agar was added. Oleic acid was emulsified by sonication in the
`presence of 0.02% Tween 40 (21).
`The YNBO (YNBD0.5O3) medium used for following optimum accumulation
`and remobilization is YNB with 0.5% glucose and 3% oleic acid. The YP2D4O3
`medium used for optimum lipid accumulation contained yeast extract (1%),
`proteose peptone (2%), glucose (4%), and oleic acid (3%).
`Typically, cultivation was performed as follows. From a YPD plate, a first
`preculture was inoculated into YPD (15 ml in 50-ml Erlenmeyer flasks, 170 rpm,
`28°C, 6 h). Cells from the preculture were used to inoculate the second precul-
`ture in YNBD medium (50 ml in 500-ml Erlenmeyer flasks, 170 rpm, 28°C,
`overnight). For the experimental culture, exponentially growing cells from the
`overnight culture were harvested by centrifugation and resuspended in fresh
`YNB medium to an optical density (A600) of 0.5.
`To determine cell growth, cultures were centrifuged at 10,000 ⫻ g for 10 min
`and the cell pellet was washed twice with equal volumes of SB solution (9 g/liter
`NaCl–0.5% bovine serum albumin). Biomass production was determined by
`measuring A600 and by estimation of the cell DW (drying at 80°C/24 h).
`General genetic techniques. Standard molecular genetic techniques were used
`throughout this study (27). Restriction enzymes were obtained from Eurogentec
`S.A. (Lie`ge, Belgium). Yeast cells were transformed by the lithium acetate
`method (19). Genomic DNA from yeast transformants was prepared as de-
`scribed by Querol et al. (25). PCR amplifications were performed on an Eppen-
`dorf 2720 thermal cycler with both Taq (Promega, Madison, WI) and Pfu (Strata-
`gene, La Jolla, CA) DNA polymerases. PCR fragments were purified with a
`QIAgen Purification Kit (Qiagen, Hilden, Germany), and DNA fragments were
`recovered from agarose gels with a QIAquick Gel Extraction Kit (Qiagen,
`
`Hilden, Germany). The Staden package of programs (8a) was used for sequence
`analysis.
`Deletion of the GUT2, LEU2, POX1, and POX6 genes, expression of Cre
`recombinase, and marker excision. The deletion cassettes were typically gener-
`ated by PCR amplification according to Fickers and coworker (12). First, the
`promoter (P) and terminator (T) regions were amplified with Y. lipolytica W29
`genomic DNA as the template and the gene-specific P1/P2 and T1/T2 oligonu-
`cleotides as primer pairs (Table 3). Primers P2 and T1 contained an extension in
`order to introduce the IsceI restriction site.
`For the GUT2 (G3PDH) gene, primer pairs G3P-P1/G3P-P2 and G3P-T1/
`G3P-T2 were used. The P and T regions were purified and used for the second
`PCR. The resulting PT fragment was cloned into pCR4Blunt-TOPO, yielding the
`JME743 construct. The URA3 marker was then introduced at the IsceI site,
`yielding the JME744 construct containing the GUT2-PUT cassette.
`For the LEU2 gene, primer pairs LEU2-P1/LEU2-P2 and LEU2-T1/LEU2-T2
`were used. P1 was designed to introduce an XbaI restriction site at the 5⬘ end of
`the P fragment, whereas T2 was designed to introduce a HindIII site. After
`amplification, the PT PCR fragment was digested with XbaI and HindIII and
`cloned into pDRIVE at corresponding sites, yielding the JME641 construct. The
`hph marker was then introduced, giving rise to JME651.
`For the POX1 and POX6 genes, the PT sequences were amplified with their
`specific primers and cloned into Bluescript KS⫹ as a blunt-ended fragment.
`After transformation into DH5␣ on LB agar containing 5-bromo-4-chloro-3-
`indolyl-␤-D-galactopyranoside (X-Gal), white colonies were selected. Strains
`MTLE34 and MTLE35 contained plasmids carrying the POX1-PT and
`POX6-PT cassettes, respectively. Strains MTLE36 and MTLE37 contained cor-
`responding plasmids POX1-PHT and POX2-PHT.
`The disruption cassettes (PUT and PHT) obtained by PCR were used for
`transformation by the lithium acetate method (4). Transformants were selected
`onto YNBcasa and YPDH, respectively. Typically, about 5 ⫻103 transformants
`were obtained per ␮g of PCR fragments. Four to eight transformants were
`analyzed by PCR with ver1/ver2 primer pairs (Table 3), giving more than 50% of
`the clones with correct gene disruption, which was confirmed by Southern blot-
`
`LCY Biotechnology Holding, Inc.
`Ex. 1034
`Page 3 of 11
`
`

`

`7782
`
`BEOPOULOS ET AL.
`
`APPL. ENVIRON. MICROBIOL.
`
`Strain (host strain)
`
`E. coli strains
`DH5␣
`
`JME459 (DH5␣)
`JME461 (DH5␣)
`JME508 (DH5␣)
`JME507 (DH5␣)
`JME743 (DH5␣)
`JME641 (DH5␣)
`MTLE34 (DH5␣)
`MTLE35 (DH5␣)
`JME744 (DH5␣)
`JME651 (DH5␣)
`MTLE36 (DH5␣)
`MTLE37 (DH5␣)
`
`Y. lipolytica strains
`W29
`Po1d
`JMY330
`MTLY40
`MTLY64
`MTLY66
`MTLY82
`MTLY85
`MTLY94
`MTLY97
`JMY1202
`JMY1351
`
`TABLE 2. E. coli and Y. lipolytica strains and plasmids used in this study
`
`Genotype or plasmid
`
`⫺ mK
`
`⫹) supE44 relA1
`
`␾80 dlacZ⌬M15 recA1 endA1 gyrA96 thi-1 hsdR17 (rK
`deoR ⌬(lacZYA-argF)U169
`pBluescript II KS⫹ (ColE1 ori LacZ bla)
`pRRQ2 (cre ARS68 LEU2 in pBluescript II KS⫹)
`1.6-kb I-SceI fragment containing hph marker, MH cassette
`1.3-kb I-SceI fragment containing URA3 marker, MU cassette
`1.6-kb PCR fragment containing ylGUT2PT cassette in pCR4Blunt-TOPO
`1.3-kb PCR fragment containing ylLEU2PT cassette in pDrive
`1.6-kb PCR fragment containing ylPOX1PT cassette in pBluescript KS⫹
`1.6-kb PCR fragment containing ylPOX6PT cassette in pBluescript KS⫹
`MU cassette in JME743, ylGUT2PUT cassette
`MH cassette in JME641, ylLEU2PHT cassette
`MU cassette in MTLE34, ylPOX1PHT cassette
`MU cassette in MTLE35, ylPOX6PHT cassette
`
`MATa WT
`MATa ura3-302 leu2-270 xpr2-322
`MATa leu2-270 xpr2-322
`MATa ura3-302 xpr2-322 ⌬pox2 ⌬pox3 ⌬pox4 ⌬pox5
`MATa ura3-302 xpr2-322 ⌬pox2 ⌬pox3 ⌬pox4 ⌬pox5 leu2::hph
`MATa ura3-302 xpr2-322 ⌬pox2 ⌬pox3 ⌬pox4 ⌬pox5 ⌬leu2
`MATa ura3-302 xpr2-322 ⌬pox2 ⌬pox3 ⌬pox4 ⌬pox5 ⌬leu2 pox1::hph
`MATa ura3-302 xpr2-322 ⌬pox2 ⌬pox3 ⌬pox4 ⌬pox5 ⌬leu2 ⌬pox1
`MATa ura3-302 xpr2-322 ⌬pox2 ⌬pox3 ⌬pox4 ⌬pox5 ⌬leu2 ⌬pox1 pox6::hph
`MATa ura3-302 xpr2-322 ⌬pox2 ⌬pox3 ⌬pox4 ⌬pox5 ⌬leu2 ⌬pox1 ⌬pox6
`MATa ura3-302 leu2-270 xpr2-322 ⌬gut2::URA3
`MATa ura3-302 xpr2-322 ⌬leu2 ⌬pox1-6 ⌬gut2::URA3
`
`Source or
`reference
`
`Promega
`
`Stratagene
`12
`12
`12
`This work
`This work
`This work
`This work
`This work
`This work
`This work
`This work
`
`1
`
`This work
`21
`This work
`This work
`This work
`This work
`This work
`This work
`This work
`This work
`
`ting, and then marker rescue was performed according to Fickers and coworkers
`(12).
`Light microscopy. For light microscopy investigations, cells from 10 ml of a
`growing yeast culture were prefixed by addition of 1.34 ml of formaldehyde stock
`solution (50 mM sodium phosphate buffer, pH 6.8; 0.5 mM MgCl2; 4.8% form-
`aldehyde) and further incubated for 1 h at28°C with shaking at 250 rpm. Prefixed
`cells were harvested, resuspended to an A600 of 2.5 in the formaldehyde stock
`solution, and incubated for 5 h atroom temperature. Cells were washed twice
`with 50 mM sodium phosphate buffer (pH 6.8) and stored in 0.1 M K-Pi buffer
`(pH 7.5) at an A600 of 2.5 at 4°C until light microscopy observation.
`Fluorescence microscopy. For visualization of LB, Nile red (1 mg/ml solution
`in acetone; Molecular Bioprobe, Montluc¸on, France) was added to the cell
`suspension (1/10, vol/vol) and incubated for 1 h atroom temperature. Cells were
`harvested, washed twice with distilled water, and resuspended in 50 mM sodium
`phosphate buffer (pH 6.8) to an A600 of 2.5. Microscopy was performed with an
`Olympus BX 51 fluorescence microscope with a 100⫻ oil immersion objective.
`Photometrics CoolSNAP software was used for recording the images.
`Lipid determination. Lipids from the equivalent of a culture optical density of
`10 were either extracted by the procedure of Folch et al. (13) for thin-layer
`chromatography (TLC) analysis or directly converted into their methyl esters
`with freeze-dried cells according to Browse et al. (7) and used for gas chroma-
`tography (GC) analysis. Complete transmethylation was verified by the BF3-in-
`methanol method (3) and on TLC plates. GC analysis of FA methyl esters was
`performed with a Varian 3900 instrument equipped with a flame ionization
`detector and a Varian FactorFour vf-23ms column, where the bleed specification
`at 260°C is 3 pA (30 m, 0.25 mm, 0.25 ␮m). FA were identified by comparison to
`commercial FA methyl ester standards (FAME32; Supelco) and quantified by
`the internal standard method by adding 50 ␮g of commercial C17:0 (Sigma). A
`C16:1(n-9) methyl ester standard was purchased from Cayman, France.
`LB quantification and analysis. LB analysis was performed by microscopic
`observation of a growing cell culture as described above. Nomarski (differential
`interference contrast) optics were used to record transmission images. LB num-
`bers and volumes at various stages of growth were calculated from images at
`different focuses. Ten representative cells were selected from light microscopy
`images to determine LB number and size. This analysis was performed with
`ImageJ picture processing software (http://rsb.info.nih.gov/ij/).
`
`FIG. 2. Schematic representation of strain construction. Auxotro-
`phic strain Po1d (Leu⫺ Ura⫺) was derived from WT strain W29. Strain
`JMY1202, carrying a disrupted G3PDH gene (gut2::URA3), was ob-
`tained by transformation of the PUTgut2 cassette into Po1d. Strain
`MTLY40, which contains four deletions of POX genes that code for
`acyl-CoA oxidases, was constructed by successive gene disruptions (21,
`29). Additional deletions of the two remaining POX genes (POX1 and
`POX6) were introduced by successive gene disruptions and marker
`rescue according to Fickers and coworkers (12); i.e., (i) a deletion of
`the LEU2 gene (leu2::hyg) was introduced into MTLY40; (ii) the
`marker was rescued after transformation with replicative plasmid
`pRRQ2, followed by plasmid loss; (iii) the POX1 gene was deleted with
`the PHTpox1 disruption cassette; (iv) the marker was rescued as in
`step ii; (v) the POX6 gene was deleted with the PHTpox6 disruption
`cassette; (vi) the marker was rescued as for step ii; and finally (vii) the
`G3PDH gene was deleted. Strain JMY1351 contained complete dele-
`tions of the six POX genes (⌬pox1-6), together with the GUT2 deletion.
`Control strain JMY330 was obtained by transformation with the p62-
`URA3 cassette containing the URA3 marker from plasmid JMP62.
`
`LCY Biotechnology Holding, Inc.
`Ex. 1034
`Page 4 of 11
`
`

`

`VOL. 74, 2008
`
`LIPID ACCUMULATION IN YARROWIA LIPOLYTICA
`
`7783
`
`Primer
`
`G3P-ver1
`G3P-P1
`G3P-P2
`G3P-T1
`G3P-T2
`G3P-ver2
`LEU2-P1
`LEU2-P2
`LEU2-T3
`LEU2-T4
`POX1-ver1
`POX1-P1
`POX1-P2
`POX1-T1
`POX1-T2
`POX1-ver2
`POX6-ver1
`POX6-P1
`POX6-P2b
`POX6-T1b
`POX6-T2
`POX6-ver2
`
`TABLE 3. Primers used in this studya
`
`Sequence (5⬘33⬘)
`
`GAATGACGGGGGCAACGCAG
`GCAGATCCACTGTCAAGCCG
`GCTAGGGATAACAGGGTAATGCGGTAGGAAAGAGAAGTTCCGCG
`GCATTACCCTGTTATCCCTAGCCGGACTATTTCCCCGCAGC
`GCAGCCAGCAGCACGTAGTAG
`CAGCAGCCACAAATAGCAGACTGCC
`AATCTAGATGGTCACAGTGGAATCATGTTCGTGG
`CATTACCCTGTTATCCCTAGGTTCCATTGTGGATGTGTGTGGTTG
`CTAGGGATAACAGGGTAATGCTCTGGGTCTGCTGCCCTC
`AGTAAGCTTAGATCTGTTCGGAAATCAACGGATGCTCAACC
`ATCCAGACCTCCAGGCGGG
`CATGGAGTGGATCGCTCGAGGACG
`GCATTACCCTGTTATCCCTAGCCAGGAGGATCGGTGAATGTG
`GCTAGGGATAACAGGGTAATGCCTTGTTCCGAGAAGAGGAGGACG
`CGGCAGTGGCTCACCAAGC
`GCTGCGTCTCAATCTGGCGAATG
`GCTCAAGAAGGTAGCTGAGTC
`CCAAGCTCTAAGATCATGGGGATCCAAG
`GCATTACCCTGTTATCCCTAGCGTTGAGGGACTGTTGAGAGAG
`GCTAGGGATAACAGGGTAATGCGATGAGGAAATTTGCTCTCTTGAGG
`ATCTCGAGATTGGTCCCCTCAAACACAC
`CATTAAGTGTCAGATCAGCTCGC
`
`Restriction site
`introduced
`
`I-SceI
`I-SceI
`
`XbaI
`I-SceI
`I-SceI
`HindIII
`
`I-SceI
`I-SceI
`
`I-SceI
`I-SceI
`
`a Underlined sequences correspond to introduced restriction sites. Primers P1, P2, T1, and T2 were used for the construction of disruption cassettes. Primers ver1
`and ver2 were used for the verification of gene disruption by PCR amplification of the genomic loci. Primers P2 and T1 contained the sequence of the IsceI
`endonuclease.
`
`Lipid fractionation. Total lipids were fractionated in TAG and FFA for lipid
`class quantification with an Isolute SPE Aminopropyl column (IST, France)
`according to reference 18. Column conditioning was performed three times with
`3 ml of hexane at a normal flow rate. One milliliter of total lipids extracted by the
`Folch method in CHCl3 was loaded onto the column, and the fraction of neutral
`lipids was collected. Total elution of neutral lipids was performed by washing the
`column three times with 3 ml of CHCl3-isopropanol (2/1). The FFA fraction was
`collected by washing the column three times with 3 ml of diethyl ether–2% acetic
`acid at a normal flow rate. Fraction solvent was evaporated under N2 flux, and
`direct transmethylation was followed for GC analysis (18). TLC plates were used
`for extraction verification. The efficiency of the procedure was further verified by
`comparison of the GC profiles of fractionated and unfractionated samples.
`TLC separation of lipid classes. Precoated TLC plates (silica G60, 20 by 20
`cm, 0.25-mm thickness) from Merck (Germany) were used. Lipid classes were
`separated with a two-development solvent system. System A (half-plate migra-
`tion) consisted of petroleum ether-ethyl ether-acetic acid at 20/20/0.8 (vol/vol/
`vol). System B (whole-plate migration) consisted of petroleum ether-diethyl
`ether at 49/1 (vol/vol). A 5% phosphomolybdic acid solution was sprayed onto
`the plates, and lipid bands were revealed after 10 min at 105°C.
`
`RESULTS
`
`Genomic comparison of lipid accumulation and degradation
`pathways between Saccharomyces cerevisiae and Y. lipolytica.
`Genes involved in lipid accumulation and mobilization path-
`ways in yeast have been recently reviewed (8). In order to
`compare those genes between S. cerevisiae (a nonoleaginous
`yeast) and Y. lipolytica (an oleaginous yeast), we used the S.
`cerevisiae protein sequences at the SGD site (http://www
`.yeastgenome.org/) and blasted them at the Ge´nolevures site
`(http://cbi.labri.fr/Genolevures/). Results are summarized in
`Table 1, including gene names, S. cerevisiae and Y. lipolytica
`sequence designations, EC numbers, percentages of amino
`acid identity, and putative enzyme functions. For the first step
`catalyzed by the glycerol kinase, a single gene (GUT1) was
`found in both yeasts. The Y. lipolytica homologue was encoded
`by YALI0F00484g, presenting 35% amino acid identity. How-
`
`ever, functional analysis was performed with mutants lacking
`GUT1 activity in order to confirm gene identity (R. Haddouche
`et al., unpublished data). The enzyme catalyzing the conver-
`sion of G3P to DHAP was encoded by YALI0B13970g in Y.
`lipolytica (GUT2, 44% amino acid identity). Two genes were
`present in S. cerevisiae (GPD1 and GPD2) for the conversion
`of DHAP to G3P as the opposite reaction, while only one gene
`was found in Y. lipolytica, presenting 52 and 61% amino acid
`identity, respectively. In S. cerevisiae, two genes, SCT1 and
`GPT2, were shown to code for proteins showing G3P acyl-
`transferase activity. A single corresponding homologue,
`highly similar to S. cerevisiae SCT1 (44% amino acid iden-
`tity; YALI0C00209g), was found in Y. lipolytica.
`In both yeasts, a single gene encodes 1-acyl-sn-G3P acyl-
`transferase; the Y. lipolytica homologue was YALI0E18964g
`(ylSLC1). Similarly, genes that code for DAG acyltransferase
`(DGA1) and phospholipid:DAG acyltransferase (LRO1) were
`each encoded by a single gene in both yeasts (YALIOE32769g
`and YALI0E16797g, respectively). Only one SE synthase
`(ARE1), homologous to are2p of S. cerevisiae, has been iden-
`tified as being encoded by YALIOF06578g. Apart from amino
`acid identity, acyltransferase gene identity was confirmed by
`functional and enzymatic analyses (unpublished data). Addi-
`tionally, the overexpression or deletion of the different acyl-
`transferases present in Y.
`lipolytica gave interesting results
`regarding enzymatic specificity and TAG formation (A. Beo-
`poulos et al., unpublished data). Three genes that code for
`triacylglycerol lipases (TGL3, TGL4, and TGL5) are present in
`S. cerevisiae for the mobilization of TAG, while only two genes
`were found in Y. lipolytica (ylTGL2 and ylTGL3, encoded by
`YALY0D17534g and YALI0F10010g, respectively). For the
`␤-oxidation process, Y. lipolytica contains six genes (POX1 to
`POX6) that code for acyl-CoA oxidases (Aox) with different
`
`LCY Biotechnology Holding, Inc.
`Ex. 1034
`Page 5 of 11
`
`

`

`7784
`
`BEOPOULOS ET AL.
`
`APPL. ENVIRON. MICROBIOL.
`
`FIG. 3. Growth (A) and total lipid accumulation (B) in the WT strain and in mutant strains with altered GUT2 and POX genotypes in
`YNBD0.5O3. The growth of the WT and mutant strains listed in Table 2 was monitored over time (A). TFA accumulation, expressed as a
`percentage of cell DW, is shown in panel B. Symbols: circles, WT strain; squares, ⌬gut2 mutant strain; triangles, ⌬gut2 ⌬pox1-6 mutant strain.
`Closed symbols correspond to growth expressed as optical density at 600 nm. Open symbols correspond to TFA content. The results are mean
`values from three independent experiments. The standard deviations were ⬍10% of the respective values.
`
`substrate specificities and different activity levels: Aox3p is
`specific for short-chain acyl-CoAs, Aox2p preferentially oxi-
`dizes long-chain acyl-CoAs, and Aox4p and Aox5p activities do
`not appear to be sensitive to the length of the aliphatic chain
`of CoA. Aox1p and Aox6p are specific for the degradation of
`dicarboxylic acids (F. Thevenieau et al., unpublished data). In
`contrast, S. cerevisiae contains only one POX gene, presenting
`33 to 35% amino acid identity with all Y. lipolytica acyl-CoA
`oxidases. The multifunctional ␤-oxidation enzyme and thiolase
`are each encoded by a single gene in both yeasts. In Y. lipolyt-
`ica, the multifunctional enzyme is encoded by YALI0E15378g
`and thiolase is encoded by YALI0E18568g. Several enzymes of
`the TAG synthesis pathway were observed in the proteome of
`the LB (2), as shown in Fig. 1.
`Construction of the strain with a deletion in the GUT2 gene.
`A GUT2-PUT disruption cassette was constructed as de-
`scribed in Materials and Methods (JME744, Table 2). This
`cassette contains the promoter and terminator regions of the
`GUT2 gene and allowed the deletion of the complete 1.2-kb
`region carrying the open reading frame that codes for G3PDH.
`The GUT2 deletion was first introduced by transformation into
`Po1d, a derivative of WT strain W29 (Table 2 and Fig. 2). The
`gene deletion was verified by PCR with primers ver1 and ver2
`and Southern blotting (data not shown). One of the strains
`containing a disrupted copy of GUT2 (⌬gut2) was designated
`JMY1202 (⌬gut2::URA3 Leu⫺ Ura⫹). As a WT control, a
`strain showing the same auxotrophy was constructed by trans-
`formation of Po1d with the U