Downloaded from https://academic.oup.com/femsyr/article/11/6/457/492132 by guest on 27 June 2024
`
`R E S E A R C H A R T I C L E
`Drug-resistant cassettes for the e⁄cient transformation ofCandida
`guilliermondiiwild-type strains
`Yoann Millerioux1, Marc Clastre1, Andrew J. Simkin1, Vincent Courdavault1, Emeline Marais1,
`Andriy A. Sibirny2,3, Thierry Noe¨ l4, Joe¨ l Cre` che1, Nathalie Giglioli-Guivarc’h1 & Nicolas Papon1
`
`1EA2106, Biomol ´ecules et Biotechnologies V ´eg ´etales, Facult ´e de Pharmacie, Universit ´e Franc¸ ois-Rabelais de Tours, Tours, France; 2Institute of Cell
`Biology, NAS of Ukraine, Lviv, Ukraine; 3Department of Biotechnology and Microbiology, University of Rzeszow, Rzeszow, Poland; and 4UMR 5234 CNRS
`Universit ´e Bordeaux 2, D ´epartement 2 Parasitologie et Mycologie Mol ´eculaire, Bordeaux, France
`
`Abstract
`
`Candida guilliermondii is an opportunistic emerging fungal agent of candidiasis
`often associated with oncology patients. This yeast also remains an interesting
`biotechnological model for the industrial production of value-added metabolites.
`The recent whole-genome sequencing of the C. guilliermondii ATCC 6260
`reference strain provides an interesting resource for elucidating new molecular
`events supporting pathogenicity, antifungal resistance and for exploring the
`potential of yeast metabolic engineering. In the present study, we designed an
`efficient transformation system for C. guilliermondii wild-type strains using both
`nourseothricin- and hygromycin B-resistant markers. To demonstrate the poten-
`tial of these drug-resistant cassettes, we carried out the disruption and the
`complementation of the C. guilliermondii FCY1 gene (which encodes cytosine
`deaminase) known to be associated with flucytosine sensitivity in yeast. These two
`new dominant selectable markers represent powerful tools to study the function of
`a large pallet of genes in this yeast of clinical and biotechnological interest.
`
`Correspondence: Nicolas Papon, EA2106,
`Biomol ´ecules et Biotechnologies V ´eg ´etales,
`Facult ´e de Pharmacie, Universit ´e Franc¸ ois-
`Rabelais de Tours, 31 avenue Monge, 37200
`Tours, France. Tel.: 133 2 47 36 72 13; fax:
`133 2 47 27 66 60; e-mail:
`nicolas.papon@univ-tours.fr
`
`Received 25 February 2011; revised 30 March
`2011; accepted 7 April 2011.
`Final version published online 9 May 2011.
`
`DOI:10.1111/j.1567-1364.2011.00731.x
`
`Editor: Andr ´e Goffeau
`
`Keywords
`transformation system; selectable markers;
`nourseothricin; hygromycin B; Candida
`guilliermondii.
`
`Introduction
`
`pounds such as xylitol (Mussatto et al., 2005), riboflavin
`(Boretsky et al., 2007), ethanol (Schirmer-Michel et al.,
`2008) or g-aminobutyric acid (Guo et al., 2009).
`The recent sequencing of the C. guilliermondii ATCC 6260
`reference strain whole genome clearly reflects the increasing
`interest of the scientific community in this yeast (Butler et al.,
`2009). All these aspects make C. guilliermondii an attractive
`model for elucidating new molecular events supporting patho-
`genicity, antifungal resistance and for exploring the potential
`of yeast metabolic engineering. The establishment of a con-
`venient transformation system becomes indispensable for
`genetic manipulations in this haploid species. A small number
`of metabolic gene markers are already available to carry out the
`genetic transformation of C. guilliermondii laboratory auxo-
`trophic strains (Boretsky et al., 1999, 2007; Millerioux et al.,
`2011). However, currently, the lack of dominant markers that
`confer resistance to various drugs precludes genetic studies in
`C. guilliermondii wild-type isolates.
`As observed in Candida albicans, the C. guilliermondii CTG
`codon encodes serine rather than leucine (referred as ‘CTG
`
`Candida guilliermondii (teleomorph Pichia guilliermondii) is
`an ascomycetous yeast widely distributed in nature and can
`be a common constituent of the normal human microbial
`communities. However, this fungal species is also an agent of
`candidiasis and has been described as an emerging pathogen
`characterized by its propensity to develop resistance to
`antifungal agents during treatment (Pfaller et al., 2006;
`Desnos-Ollivier et al., 2008; Savini et al., 2011). More
`precisely, recent studies specified that C. guilliermondii
`accounts for 1–3% of all candidemia and that most cases of
`C. guilliermondii
`infection are associated with oncology
`patients (Girmenia et al., 2006; Pfaller et al., 2006). Besides
`its clinical relevance, C. guilliermondii also remains an
`interesting biotechnological model for the industrial pro-
`duction of value-added metabolites (Leather, 2003). The
`extraordinary capacity of C. guilliermondii to metabolize C5
`sugars from hemicellulosic plant byproducts is nowadays
`studied by various teams in order to produce biocom-
`
`YEAST RESEARCH
`
`FEMS Yeast Res 11 (2011) 457–463
`
`c 2011 Federation of European Microbiological Societies
`Published by Blackwell Publishing Ltd. All rights reserved
`
`LCY Biotechnology Holding, Inc.
`Ex. 1042
`Page 1 of 7
`
`

`

`458
`
`Y. Millerioux et al.
`
`clade’), which is not the case for more distantly related species
`from the ‘whole-genome duplication’ clade including Saccharo-
`myces cerevisiae and Candida glabrata (Butler et al., 2009).
`Therefore, over the last decade, some effort was focused on the
`adaptation of drug-resistant genes (often with alternative
`leucine codons),
`initially used in Escherichia coli and S.
`cerevisiae, to favor their expression in species belonging to the
`CTG clade. Four Candida drug-resistant markers are currently
`0
`-monopho-
`available: the IMH3 marker encoding inosine 5
`sphate dehydrogenase, which confers resistance to mycophe-
`nolic acid (K¨ohler et al., 1997; Staib et al., 2000; Beckerman
`et al., 2001; G´acser et al., 2005), the ble marker encoding a
`glyoxalase, which confers resistance to the bleomycin/phleomy-
`cin/zeocin group (Tang et al., 2003; Dmytruk et al., 2006;
`Laplaza et al., 2006; Wang et al., 2006), the SAT-1 marker
`encoding nourseothricin acetyltransferase, which confers resis-
`tance to nourseothricin (Roemer et al., 2003; Reuss et al., 2004;
`Shen et al., 2005), and the HPH# marker encoding hygromycin
`phosphotransferase, which confers resistance to hygromycin B
`(Hara et al., 2000; Yehuda et al., 2001; Basso et al., 2010).
`In the present work, we adapted two of the aforemen-
`tioned selectable genes, nourseothricin and hygromycin B
`drug-resistant markers, to generate cassettes for their use in
`C. guilliermondii and we evaluated their applicability for the
`efficient genetic transformation of various wild-type strains.
`
`Materials and methods
`
`Strains and media
`
`Four C. guilliermondii wild-type strains from the Centre
`National de R´ef´erence Mycologie et Antifongiques of the
`Institut Pasteur (ODL9-811, ODL9-846, ODL12-1131 and
`MYCO55-BD), the whole genome sequenced reference strain
`from the American Type Culture Collection (ATCC 6260) and
`the ATCC 6260 derived ura5 mutant NP566U (Millerioux
`
`Table 1. Oligonucleotides
`
`et al., 2011) were used in our investigations. Yeast strains were
`routinely cultivated in liquid YPS medium (1% yeast extract,
`2% peptone, 2% sucrose) at 30 1C under agitation (150 r.p.m.).
`Nourseothricin (Werner BioAgents, stock solution prepared in
`1) and hygromycin B
`water at a concentration of 100 mg mL
`(Sigma-Aldrich, stock solution prepared in water at a concen-
`1) were added when necessary at the
`tration of 25 mg mL
`indicated concentration (see figure legends). YNB (0.67% yeast
`nitrogen base with ammonium sulfate and without amino
`acids, 2% sucrose) was supplemented or not with flucytosine
`(Sigma-Aldrich, stock solution prepared in water at a concen-
`1) as required. Solid media were pre-
`tration of 12.8 mg mL
`pared with 2% agar.
`
`PCR amplifications
`
`For plasmid constructions, SAT-1 and HPH# coding se-
`quences were amplified with Pfu (Promega). Yeast colony
`PCRs were performed as described in Akada et al. (2000)
`with GoTaq polymerase (Promega). The integration of the
`SAT-1 marker into nourseothricin-resistant colonies was
`confirmed by PCR using primers SAT1S and SAT2R (Table
`1). The integration of the HPH# marker into hygromycin B-
`resistant colonies was confirmed by PCR using primers
`HYGS1 and HYGR2 (Table 1). The FCY1-disrupted strains
`were first screened by PCR with primers FCY11 and FCY12
`(Table 1). The FCY1 gene disruption was then authenticated
`following PCRs using primers SAT1S or SAT2R with pri-
`mers located outside of the homology arms (not shown).
`The FCY1-complemented strains were screened by PCR
`using primers FCY11 and HYGR2. PCR conditions for
`amplification were those indicated by the supplier.
`
`Plasmids construction
`
`To construct plasmid pURA5-SAT-1, the 522 bp SAT-1
`coding sequence was amplified with primers SAT1S and
`
`Downloaded from https://academic.oup.com/femsyr/article/11/6/457/492132 by guest on 27 June 2024
`
`Sequence (5
`
`0
`
`0
`
`)
`
`–3
`
`CTGAGACTCGAGATGAAAATTTCGGTGATCCCTG
`CTGAGACTGCAGGGCGTCATCCTGTGCTCCCGAG
`CTGAGACTCGAGATGAAAAAGCCTGAACTCACCG
`CTGAGACTGCAGTTCCTTTGCCCTCGGACGAGTG
`GACTACAGTAAGGTGAACATCACC
`GTCACCCTCCATAGGGAGCACTGG
`CAGTGAGCTCGGAACGAGGTTTCC
`GCAAGCAGCAGACGCTACCAATGG
`GGTACCTCTAGAATCGATTGATCAGTCGACGGAGGAGTCTTCCGCAAGAGCC
`TGATCAATCGATTCTAGAGGTACCGGCGAGTTGTTGATGAAGATCTTG
`
`Sources/references
`
`This study
`This study
`This study
`This study
`Millerioux et al. (2011)
`Millerioux et al. (2011)
`Millerioux et al. (2011)
`Millerioux et al. (2011)
`This study
`This study
`
`Primers
`
`
`w
`
`
`w
`
`SAT1S
`SAT2R
`HYGS1
`HYGR2
`FCYS
`FCYR
`FCY11
`FCY12
`z
`PGKP5
`‰
`PGKT6
`
`
`The underlined sequence corresponds to the XhoI site.
`w
`The underlined sequence corresponds to the PstI site.
`z
`The underlined sequence corresponds to the KpnI, XbaI, ClaI, BclI and SalI sites.
`‰
`The underlined sequence corresponds to the KpnI, XbaI, ClaI and BclI sites.
`
`c 2011 Federation of European Microbiological Societies
`Published by Blackwell Publishing Ltd. All rights reserved
`
`FEMS Yeast Res 11 (2011) 457–463
`
`LCY Biotechnology Holding, Inc.
`Ex. 1042
`Page 2 of 7
`
`

`

`Drug-resistant cassettes for Candida guilliermondii
`
`459
`
`Downloaded from https://academic.oup.com/femsyr/article/11/6/457/492132 by guest on 27 June 2024
`
`Fig. 1. Transformation of the NP566U strain with pURA5-SAT-1 or pURA5-HPH#. (a) Schematic representation of pURA5-SAT-1. The XbaI unique site
`was used for linearization before transformation. (b) Schematic representation of pURA5-HPH#. (c) Nourseothricin and hygromycin B sensitivity of
`transformants. Nourseothricin and hygromycin B resistances tests were carried out for each strain by streaking ATCC 6260, NP566U and three
`
`1) or hygromycin B (500 mg mL1).
`representative clones from each transformation onto YPS supplemented or not with nourseothricin (150 mg mL
`
`SAT2R (Table 1) using the pSFS2 plasmid (Reuss et al.,
`2004) as a template. This fragment was digested at its
`extremities by XhoI and PstI and cloned between XhoI and
`PstI sites of pURA5-GFP (unpublished plasmid) after
`releasing of the yeGFP coding sequence, resulting in pURA5-
`SAT-1 (Fig. 1a). To obtain plasmid pURA5-HPH#, the
`1023 bp HPH# coding sequence was amplified with primers
`HYGS1 and HYGR2 (Table 1) using the pRS-HYG# plasmid
`(Hara et al., 2000) as a template. This fragment was digested
`at its extremities by XhoI and PstI and cloned between XhoI
`and PstI sites of pURA5-GFP after the release of the yeGFP
`coding sequence, resulting in pURA5-HPH# (Fig. 1b). To
`construct plasmid pG-SAT-1 and pG-HPH#, SAT-1 and
`HPH# (each bordered by C. guilliermondii phosphoglycerate
`kinase transcription-regulating sequences) were amplified
`with primers PGKP5 and PGKT6 (Table 1) and each cloned
`into pGEMT easy vector (Promega) (Fig. 2). To obtain
`0
`0
`FCY1, pG-
`FCY1-PGKpro-SAT-1-PGKter-3
`plasmid pG-5
`FCY1 (Millerioux et al., 2011) was digested with NarI, which
`is located at the center of the FCY1 coding sequence (Fig.
`3b). The resulting digested plasmid was ligated to the SAT-1
`fragment (bordered by C. guilliermondii phosphoglycerate
`kinase transcription-regulating sequences) released after the
`0
`FCY1-
`digestion of the pG-SAT-1 plasmid by ClaI. The 5
`0
`FCY1 disruption cassette was gen-
`PGKpro-SAT-1-PGKter-3
`erated using primers FCYS and FCYR (Table 1) and pG-
`0
`0
`FCY1 as a template. For
`FCY1-PGKpro-SAT-1-PGKter-3
`5
`
`constructing the complementation vector p-FCY1-HPH#
`(Fig. 4b), pG-FCY1 was digested with SpeI and ligated to the
`HPH# fragment (bordered by C. guilliermondii phosphogly-
`cerate kinase transcription-regulating sequences) released
`after the digestion of the pG-HPH# plasmid by XbaI.
`
`Yeast transformation
`
`Transformation of C. guilliermondii cells was performed
`using a lithium acetate procedure as described previously
`(Boretsky et al., 2007). After heat shock, cells were pelleted
`(3500 g, 10 min) and suspended in 3 mL YPS, incubated for
`5 h at 30 1C under agitation (150 r.p.m.), centrifuged
`(3500 g, 5 min), resuspended in 100 mL 1 M sucrose, plated
`onto selective medium and incubated at 30 1C for 3–5 days.
`
`Results and discussion
`
`Sensitivity of C. guilliermondiistrains to
`nourseothricin and hygromycin B
`
`We initiated this work by testing the sensitivity of
`C. guilliermondii strains toward nourseothricin and hygro-
`mycin B. Complete inhibition of
`the growth of all
`strains (ODL9-811, ODL9-846, ODL12-1131, MYCO55-
`BD and ATCC 6260) was observed (after 4 days of culture)
`1 nourseothricin or
`on YPS plates containing 150 mg mL
`1 hygromycin B.
`500 mg mL
`
`FEMS Yeast Res 11 (2011) 457–463
`
`c 2011 Federation of European Microbiological Societies
`Published by Blackwell Publishing Ltd. All rights reserved
`
`LCY Biotechnology Holding, Inc.
`Ex. 1042
`Page 3 of 7
`
`

`

`460
`
`Y. Millerioux et al.
`
`Downloaded from https://academic.oup.com/femsyr/article/11/6/457/492132 by guest on 27 June 2024
`
`Fig. 2. (a) Selection and characterization of nourseothricin-resistant colonies after the transformation of Candida guilliermondii with plasmid pG-SAT-1.
`
`single site restriction enzymes) and representative plates of selection for nourseothricin resistance 4 days (30 1C) after
`A representation of pG-SAT-1 (
`the transformation of C. guilliermondii cells (ODL9-846) with sterile water (control) or 5 mg of linearized pG-SAT-1 are shown. The ApaI unique site was
`used for linearization before transformation. Yeast colony PCR on a subset of 15 randomly selected clones was performed using specific primers (SAT1S
`and SAT2R) to amplify the SAT-1 sequence. (b) Selection and characterization of hygromycin B-resistant colonies after transformation with plasmid pG-
`HPH#. A representation of pG-HPH# and representative plates of selection for hygromycin B resistance 4 days after the transformation of C.
`guilliermondii cells (ODL9-846) with sterile water (control) or 5 mg of linearized pG-HPH# are shown. The ApaI unique site was used for linearization
`before transformation. Yeast colony PCR on a subset of 15 randomly selected clones was performed using specific primers (HYGS1 and HYGR2) to
`amplify the HPH# sequence. Single site restriction enzymes are marked in bold with an asterisk.
`
`Expression of codon-optimized SAT-1and HPH#
`genes in C. guilliermondii
`
`
`In a first series of experiments, we failed to obtain anya first series of experiments, we failed to obtain any
`nourseothricin- and hygromycin B-resistant transformants
`nourseothricin- and hygromycin B-resistant transformants
`when we attempted to transform C. guilliermondii strains
`when we attempted to transform C. guilliermondii strains
`with 0.2, 1 or 5 mg of pSFS2 plasmid (Reuss et al., 2004) and
`with 0.2, 1 or 5 mg of pSFS2 plasmid (Reuss et al., 2004) and
`pRS-HYG# plasmid (Hara et al., 2000), respectively. ThepRS-HYG# plasmid (Hara et al., 2000), respectively. The
`
`SAT-TT 1 coding sequence is under
`the control of
`the
`SAT-1 coding sequence is under
`the control of
`the
`C. albicans ACT1 promoter and the C. albicans URA3
`C. albicans ACT1 promoter and the C. albicans URA3
`terminator in plasmid pSFS2 (Reuss et al., 2004), whereas
`terminator in plasmid pSFS2 (Reuss et al., 2004), whereas
`the HPH# coding sequence is bordered by the Candidathe HPH#HH coding sequence is bordered by the Candida
`
`tropicalis phosphoglycerate kinase promoter and terminator
`tropicalis phosphoglycerate kinase promoter and terminator
`(Hara et al., 2000). It is thus likely that these heterologous
`(Hara et al., 2000). It is thus likely that these heterologous
`transcription-regulating sequences preclude the expression
`transcription-regulating sequences preclude the expression
`of SAT-1 and HPH# in C. guilliermondii.of SAT-TT 1 and HPH#HH in C. guilliermondii.
`
`For this reason, we placed SAT-1 and HPH# under the
`control
`of C.
`guilliermondii
`transcription-regulating
`sequences. We constructed two plasmids composed of (1)
`the pGEM-T backbone vector; (2) the recently developed
`C. guilliermondii URA5 selection marker (Millerioux et al.,
`2011);
`(3) a 626-bp sequence corresponding to the
`
`C. guilliermondii phosphoglycerate kinase 1 (PGK) gene
`promoter (PGKpro); (4) a codon-optimized SAT-1 or HPH#
`coding sequence (SAT-1 in pURA5-SAT-1 and HPH# in
`pURA5-HPH#); and (5) a 659-bp sequence corresponding
`to the C. guilliermondii PGK terminator (PGKter) (Fig. 1). To
`demonstrate the capacity of these constructs to confer
`nourseothricin or hygromycin B resistance in C. guillier-
`mondii, we transformed to prototrophy the NP566U strain
`(an ura5 mutant derived from ATCC 6260, Millerioux et al.,
`2011) with 500 ng of linearized pURA5-SAT-1 or pURA5-
`HPH#. More than 90% of the clones selected on YNB
`medium after transformation with pURA5-SAT-1 were
`nourseothricin resistant and similar percentages of the
`clones selected on YNB medium after transformation with
`pURA5-HPH# were hygromycin B resistant (Fig. 1). These
`data indicate that PGK transcription-regulating sequences
`allow a constitutive expression of SAT-1 and HPH# that
`confers nourseothricin and hygromycin B resistance to
`C. guilliermondii cells, respectively. Furthermore,
`these
`results show that SAT-1 does not confer hygromycin B
`resistance and HPH# does not confer nourseothricin resis-
`tance in this species.
`
`c 2011 Federation of European Microbiological Societies
`Published by Blackwell Publishing Ltd. All rights reserved
`
`FEMS Yeast Res 11 (2011) 457–463
`
`LCY Biotechnology Holding, Inc.
`Ex. 1042
`Page 4 of 7
`
`

`

`Drug-resistant cassettes for Candida guilliermondii
`
`461
`
`Downloaded from https://academic.oup.com/femsyr/article/11/6/457/492132 by guest on 27 June 2024
`
`Fig. 3. Disruption of the Candida guilliermondii
`FCY1 gene using the SAT-1 marker. (a) For each
`strain derived from the MYCO55-BD transfor-
`0
`FCY1-PGKpro-SAT-1-PGKter-
`mation with the 5
`0
`FCY1 cassette, the FCY1 locus was analyzed by
`3
`yeast colony PCR using FCY11 and FCY12 pri-
`mers. Five microliters of washed cells (105 cells)
`were spotted onto YPS supplemented or not
`1 nourseothricin. Flucytosine
`with 150 mg mL
`resistance was shown by spotting cells onto
`1 flucytosine.
`YNB supplemented with 8 mg mL
`(b) Schematic representation of the resident loci
`(the hatched box corresponds to an intron
`identified in the FCY1 coding sequence).
`
`Direct transformation of C. guilliermondiiusing
`SAT-1and HPH# dominant markers
`
`With the goal to facilitate molecular manipulations, we
`constructed two plasmids, pG-SAT-1 and pG-HPH#, har-
`boring the PGKpro-SAT-1-PGKter or PGKpro-HPH#-PGKter
`cassettes bordered by two multiple cloning sites (Fig. 2). To
`test whether the two cassettes could be used directly as
`selectable markers in C. guilliermondii strains, we trans-
`formed the ODL9-846 strain with 0.2, 1 or 5 mg of linearized
`pG-SAT-1 or pG-HPH#. No resistant clones were selected
`when the ODL9-846 strain was transformed with 0.2 or 1 mg
`of pG-SAT-1 or pG-HPH#. However, 50–200 nourseothri-
`cin- and hygromycin B-resistant clones were obtained when
`the ODL9-846 strain was transformed with 5 mg of pG-SAT-
`1 and pG-HPH#, respectively (Fig. 2).
`To verify that nourseothricin or hygromycin B resistance
`derived from the integration of the cassettes, we performed
`yeast colony PCR on a subset of 15 randomly selected clones
`using specific primers to amplify SAT-1 or HPH# sequences.
`As shown in Fig. 2, all screened nourseothricin- or hygro-
`mycin B-resistant colonies displayed PCR products con-
`formable with the presence of the SAT-1 or the HPH#
`sequence, respectively. These results suggest that SAT-1 and
`HPH# markers were incorporated into the genome of the
`ODL9-846 strain and provide evidence that PGKpro-SAT-1-
`PGKter or PGKpro-HPH#-PGKter cassettes could be used
`directly as dominant selection markers in C. guilliermondii
`wild-type strains.
`
`Disruption of the FCY1gene: an example of gene
`knockout in C. guilliermondiiwild-type strains
`using the SAT-1marker
`
`To demonstrate the potential of these new drug-resistant
`markers in C. guilliermondii, we attempted, as an example,
`the disruption and subsequently the complementation of a
`gene that allows for easy mutant phenotype screening. We
`chose the FCY1 gene encoding cytosine deaminase (involved
`in the pyrimidine salvage pathway) because the fcy1 deletion
`in C. guilliermondii leads to strong flucytosine resistance
`(Millerioux et al., 2011).
`The SAT-1 marker was first chosen to disrupt the FCY1
`gene in the five C. guilliermondii wild-type strains. For this
`0
`0
`FCY1 fragment
`FCY1-PGKpro-SAT-1-PGKter-3
`purpose, a 5
`0
`0
`and 3
`FCY1 homologous arms was
`with 2000 bp of the 5
`generated by PCR and used to transform the C. guilliermon-
`dii strains. Transformants derived from each host strain
`1 nourseothricin-containing YPS
`(selected onto 150 mg mL
`plates) were subjected to flucytosine sensitivity testing and
`to PCR analysis. For all the screened clones, the flucytosine
`resistance phenotype was concomitant with homologous
`0
`0
`FCY1
`FCY1-PGKpro-SAT-1-PGKter-3
`integration of
`the 5
`cassette at the FCY1 locus (genotype fcy1SAT-1). Interestingly,
`PCR and phenotypic analyses showed that the FCY1 gene
`had been replaced by homologous recombination in all the
`five transformed C. guilliermondii strains with variable
`targeting frequencies (Table 2). The best percentage of
`homologous targeting was obtained with the MYCO55-BD
`
`FEMS Yeast Res 11 (2011) 457–463
`
`c 2011 Federation of European Microbiological Societies
`Published by Blackwell Publishing Ltd. All rights reserved
`
`LCY Biotechnology Holding, Inc.
`Ex. 1042
`Page 5 of 7
`
`

`

`Downloaded from https://academic.oup.com/femsyr/article/11/6/457/492132 by guest on 27 June 2024
`
`462
`
`Y. Millerioux et al.
`
`Fig. 4. Complementation of the fcy1SAT-1-
`disrupted allele using the HPH# marker. (a) For
`each strain derived from the transformation of a
`representative MYCO55-BD fcy1SAT-1 mutant
`with p-FCY1-HPH#, the integration of the
`complementation plasmid was analyzed by yeast
`colony PCR using FCY11 and HYGR2 primers.
`Five microliters of washed cells (105 cells) were
`spotted onto YPS supplemented or not with
`1 hygromycin B. Flucytosine resis-
`500 mg mL
`tance was shown by spotting cells onto YNB
`1 flucytosine.
`supplemented with 8 mg mL
`F: MYCO55-BD fcy1SAT-1parental strain used
`for transformation. (b) Schematic representation
`of the complementation plasmid. The XbaI
`unique site was used for linearization before
`transformation.
`
`Table 2. Homologous targeting frequencies of Candida guilliermondii
`0
`0
`FCY1
`FCY1-PGKpro-SAT-1-PGKter-3
`strains
`transformed with the 5
`disruption cassette
`
`No. of
`transformants
`
`No. of flucytosine-
`resistant clones
`
`Homologous
`targeting
`frequency (%)
`
`191
`137
`42
`15
`82
`
`6
`4
`2
`3
`3
`
`3.1
`2.9
`4.8
`20
`3.7
`
`Strains
`
`ODL9-811
`ODL9-846
`ODL12-1131
`MYCO55-BD
`ATCC 6260
`
`strain (flucytosine sensitivity testing and PCR analysis are
`given as an example in Fig. 3). For the remaining nourseo-
`thricin-resistant and flucytosine-sensitive transformants, it
`is highly likely that they were derived from gene replacement
`at the PGK locus or ectopic integration (not studied).
`
`The use of the HPH# marker for
`complementation of the fcy1 null allele
`
`In order to validate the capacity of the second available drug-
`resistant marker, i.e. HPH# to carry out the complementation
`of the fcy1SAT-1-disrupted allele, we constructed a plasmid that
`contained both the FCY1 wild-type allele and the PGKpro-
`HPH#-PGKter cassette (p-FCY1-HPH#, Fig. 4). This comple-
`mentation vector was linearized and was used to transform
`two fcy1SAT-1 mutants (one derived from ODL9-811 and the
`other derived from MYCO55-BD). Transformants derived
`1 hygromycin
`from both host strains (selected onto 500 mg mL
`B-containing YPS plates) were subjected to flucytosine sensi-
`tivity testing and to PCR analysis. For all screened clones, the
`restored flucytosine
`sensitivity phenotype
`(30–50% of
`screened transformants) was concomitant with the integration
`of the complementation plasmid (Fig. 4).
`
`Conclusion
`
`In summary, the present study describes the development of
`an efficient transformation system for C. guilliermondii
`wild-type strains based on two new drug-resistant markers.
`The hygromycin B-resistant markers were already used as
`the selection gene in various yeast and filamentous species
`(for a review, see Weld et al., 2006). Nevertheless, nourseo-
`thricin-resistant markers are rarely used for the transforma-
`tion of fungi (for a review, see Basso et al., 2010). Although
`our results suggest, as revealed in other previous studies
`(Boretsky et al., 2007; Millerioux et al., 2011), that trans-
`formed DNA is predominantly randomly integrated in
`C. guilliermondii, this work firmly demonstrates the poten-
`tial of these two new selection markers to perform gene
`disruption/complementation in wild-type strains. We con-
`clude that
`they represent powerful
`tools to study the
`function of a large pallet of genes, especially involved in
`antifungal resistance, pathogenicity, and for metabolic en-
`gineering in this emerging yeast.
`
`Acknowledgements
`
`We thank Atsuo Tanaka (Laboratory of Applied Biological
`Chemistry, Kyoto University, Japan) and Joachim Morschh¨au-
`ser (Institut f¨ur Molekulare Infektionsbiologie, Universit¨at
`W¨urzburg, Deutschland) for providing pRS-HYG# and pSFS2,
`respectively. We acknowledge Franc¸oise Dromer and Marie
`Desnos-Ollivier (National Reference Center for Mycoses and
`Antifungals, Institut Pasteur, Paris, France) for providing C.
`guilliermondii strains. We also thank Martin Goldway (Galilee
`Technological Center, Tel-Hai Academic College, Israel) for his
`precious advice. We acknowledge the Broad Institute Fungal
`Genome Initiative for making the complete genome sequence
`of C. guilliermondii available. We thank ‘Le STUDIUM’
`(Centre region, France) for the financial support of A.J.S.
`
`c 2011 Federation of European Microbiological Societies
`Published by Blackwell Publishing Ltd. All rights reserved
`
`FEMS Yeast Res 11 (2011) 457–463
`
`LCY Biotechnology Holding, Inc.
`Ex. 1042
`Page 6 of 7
`
`

`

`Downloaded from https://academic.oup.com/femsyr/article/11/6/457/492132 by guest on 27 June 2024
`
`Drug-resistant cassettes for Candida guilliermondii
`
`463
`
`References
`
`Akada R, Murakane T & Nishizawa Y (2000) DNA extraction
`method for screening yeast clones by PCR. Biotechniques 28:
`668–674.
`Basso LR Jr, Bartiss A, Mao Y, Gast CE, Coelho PS, Snyder M &
`Wong B (2010) Transformation of Candida albicans with a
`synthetic hygromycin B resistance gene. Yeast 27: 1039–1048.
`Beckerman J, Chibana H, Turner J & Magee PT (2001) Single-copy
`IMH3 allele is sufficient to confer resistance to mycophenolic
`acid in Candida albicans and to mediate transformation of
`clinical Candida species. Infect Immun 69: 108–114.
`Boretsky Y, Voronovsky A, Liuta-Tehlivets O, Hasslacher M,
`Kohlwein SD & Shavlovsky GM (1999) Identification of an
`ARS element and development of a high efficiency
`transformation system for Pichia guilliermondii. Curr Genet
`36: 215–221.
`Boretsky YR, Pynyaha YV, Boretsky VY, Kutsyaba VI, Protchenko
`OV, Philpott CC & Sibirny AA (2007) Development of a
`transformation system for gene knock-out in the flavinogenic
`yeast Pichia guilliermondii. J Microbiol Meth 70: 13–19.
`Butler G, Rasmussen MD, Lin MF et al. (2009) Evolution of
`pathogenicity and sexual reproduction in eight Candida
`genomes. Nature 459: 657–662.
`Desnos-Ollivier M, Ragon M, Robert V, Raoux D, Gantier JC &
`Dromer F (2008) Debaryomyces hansenii (Candida famata), a
`rare human fungal pathogen often misidentified as Pichia
`guilliermondii (Candida guilliermondii). J Clin Microbiol 46:
`3237–3242.
`Dmytruk KV, Voronovsky AY & Sibirny AA (2006) Insertion
`mutagenesis of the yeast Candida famata (Debaryomyces
`hansenii) by random integration of linear DNA fragments.
`Curr Genet 50: 183–191.
`G´acser A, Salomon S & Sch¨afer W (2005) Direct transformation
`of a clinical isolate of Candida parapsilosis using a dominant
`selection marker. FEMS Microbiol Lett 245: 117–121.
`Girmenia C, Pizzarelli G, Cristini F, Barchiesi F, Spreghini E,
`Scalise G & Martino P (2006) Candida guilliermondii fungemia
`in patients with hematologic malignancies. J Clin Microbiol 44:
`2458–2464.
`Guo XF, Aoki H, Hagiwara T, Masuda K & Watabe S (2009)
`Identification of high gamma-aminobutyric acid producing
`marine yeast strains by physiological and biochemical
`characteristics and gene sequence analyses. Biosci Biotech Bioch
`73: 1527–1534.
`Hara A, Ueda M, Misawa S, Matsui T, Furuhashi K & Tanaka A
`(2000) A mutated hygromycin resistance gene is functional in
`the n-alkane-assimilating yeast Candida tropicalis. Arch
`Microbiol 173: 187–192.
`K¨ohler GA, White TC & Agabian N (1997) Overexpression of a
`cloned IMP dehydrogenase gene of Candida albicans confers
`resistance to the specific inhibitor mycophenolic acid. J
`Bacteriol 179: 2331–2338.
`Laplaza JM, Rivas Torres B, Jin YS & Jeffries TW (2006) Sh ble and
`Cre adapted for functional genomics and metabolic
`engineering of Pichia stipitis. Enzyme Microb Tech 38: 741–747.
`
`Leather TD (2003) Bioconversions of maize residues to value-
`added coproducts using yeast-like fungi. FEMS Yeast Res 3:
`133–140.
`Millerioux Y, Clastre M, Simkin AJ, Marais E, Sibirny AA, Noe¨l T,
`Cre`che J, Giglioli-Guivarc’h N & Papon N (2011)
`Development of a URA5 integrative cassette for gene
`disruption in the Candida guilliermondii ATCC 6260 strain.
`J Microbiol Meth 84: 355–358.
`Mussatto SI, Santos JC, Filho WC & Silva SS (2005) Purification
`of xylitol from fermented hemicellulosic hydrolyzate using
`liquid–liquid extraction and precipitation techniques.
`Biotechnol Lett 27: 1113–1115.
`Pfaller MA, Diekema DJ, Mendez M, Kibbler C, Erzsebet P, Chang
`SC, Gibbs DL & Newell VA (2006) Candida guilliermondii, an
`opportunistic fungal pathogen with decreased susceptibility to
`fluconazole: geographic and temporal trends from the
`ARTEMIS DISK antifungal surveillance program. J Clin
`Microbiol 44: 3551–3556.
`Reuss O, Vik A, Kolter R & Morschh¨auser J (2004) The SAT1
`flipper, an optimized tool for gene disruption in Candida
`albicans. Gene 341: 119–127.
`Roemer T, Jiang B, Davison J et al. (2003) Large-scale essential
`gene identification in Candida albicans and applications to
`antifungal drug discovery. Mol Microbiol 50: 167–181.
`Savini V, Catavitello C, Onofrillo D, Masciarelli G, Astolfi D,
`Balbinot A, Febbo F, D’Amario C & D’Antonio D (2011) What
`do we know about Candida guilliermondii? A voyage
`throughout past and current literature about this emerging
`yeast. Mycoses, DOI: 10.1111/j.1439-0507.2010.01960.x.
`Schirmer-Michel AC, Floˆ res SH, Hertz PF, Matos GS & Ayub MA
`(2008) Production of ethanol from soybean hull hydrolysate
`by osmotolerant Candida guilliermondii NRRL Y-2075.
`Bioresource Technol 99: 2898–2904.
`Shen J, Guo W & K¨ohler JR (2005) CaNAT1, a heterologous
`dominant selectable marker for transformation of Candida
`albicans and other pathogenic Candida species. Infect Immun
`73: 1239–1242.
`Staib P, Michel S, K¨ohler G & Morschh¨auser J (2000) A molecular
`genetic system for the pathogenic yeast Candida dubliniensis.
`Gene 242: 393–398.
`Tang SJ, Sun KH, Sun GH, Chang TY, Wu WL & Lee GC (2003)
`A transformation system for the nonuniversal CUG(Ser)
`codon usage species Candida rugosa. J Microbiol Meth 52:
`231–238.
`Wang X, Li G, Deng Y, Yu X & Chen F (2006) A site-directed
`integration system for the nonuniversal CUG(Ser) codon
`usage species Pichia farinosa by electroporation. Arch Microbiol
`184: 419–424.
`Weld RJ, Plummer KM, Carpenter MA & Ridgway HJ (2006)
`Approaches to functional genomics in filamentous fungi. Cell
`Res 16: 31–44.
`Yehuda H, Droby S, Wisniewski M & Goldway M (2001) A
`transformation system for the biocontrol yeast, Candida
`oleophila, based on hygromycin B resistance. Curr Genet 40:
`282–287.
`
`FEMS Yeast Res 11 (2011) 457–463
`
`c 2011 Federation of European Microbiological Societies
`Published by Blackwell Publishing Ltd. All rights reserved
`
`LCY Biotechnology Holding, Inc.
`Ex. 1042
`Page 7 of 7
`
`