Chemico-Biological Interactions 248 (2016) 36e51
`
`Contents lists available at ScienceDirect
`
`Chemico-Biological Interactions
`
`j o u r n a l h o m e p a g e : w w w . e l s e v i e r . c o m / l o c a t e / c h e m b i o i n t
`
`Recent conjugation strategies of small organic fluorophores and
`ligands for cancer-specific bioimaging
`
`Yonghwang Ha, Hyun-Kyung Choi*
`
`Department of Biomedicinal Chemistry, Jungwon University, Munmu-ro 85, Goesan-gun, Chungbuk 367-805, Republic of Korea
`
`a r t i c l e i n f o
`
`a b s t r a c t
`
`Article history:
`Received 3 November 2015
`Received in revised form
`2 February 2016
`Accepted 8 February 2016
`Available online 16 February 2016
`
`Keywords:
`Near-infrared
`Fluorescent diagnosis
`Cancer-specific ligands
`Cancer-specific receptors
`Cancer-specific biomarkers
`
`Contents
`
`Conjugation between various small fluorophores and specific ligands has become one of the main
`strategies for bioimaging in disease diagnosis, medicinal chemistry, immunology, and fluorescence-
`guided surgery, etc. Herein, we present our review of recent studies relating to molecular fluorescent
`imaging techniques for various cancers in cell-based and animal-based models. Various organic fluo-
`rophores, especially near-infrared (NIR) probes, have been employed with specific ligands. Types of li-
`gands used were small molecules, peptides, antibodies, and aptamers; each has specific affinities for
`cellular receptor proteins, cancer-specific antigens, enzymes, and nucleic acids. This review can aid in the
`selection of cancer-specific ligands and fluorophores, and may inspire the further development of new
`conjugation strategies in various cellular and animal models.
`© 2016 Elsevier Ireland Ltd. All rights reserved.
`
`1.
`2.
`
`3.
`
`4.
`
`. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 37
`Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
`Requirements for fluorophore selection and fluorescence application techniques . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
`. . . . . . . . . . . . . . . . . . . . . . . . . . . 37
`2.1.
`Factors impacting fluorophores selection . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 37
`2.2.
`Synthesis of fluorophores . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 37
`2.3.
`Strategies for selective imaging with high signal to background ratio . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
`. . . . . . . . . . . . . . . . . . . . . . . . . . . . . 37
`2.4.
`Conjugation techniques between fluorophores and ligands . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
`. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 39
`Conjugation of specific ligands with fluorophores for diagnostic imaging of various tumors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 39
`3.1.
`Lung cancer . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 39
`3.2.
`Breast cancer . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
`. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 42
`3.3.
`Pancreatic cancer . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 43
`3.4.
`Ovarian cancer . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
`. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 44
`3.5.
`Lymphoma . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 45
`3.6.
`Prostate cancer . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
`. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 45
`3.7.
`Other cancers and cancer-related biological targets . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 46
`3.8.
`Perspectives . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 47
`Conclusions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
`. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 48
`Acknowledgements . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
`. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 48
`Transparency document . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
`. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 48
`Abbreviations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
`. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 48
`References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
`. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 49
`
`* Corresponding author.
`E-mail address: hkchoi45@jwu.ac.kr (H.-K. Choi).
`
`http://dx.doi.org/10.1016/j.cbi.2016.02.006
`0009-2797/© 2016 Elsevier Ireland Ltd. All rights reserved.
`
`

`

`Y. Ha, H.-K. Choi / Chemico-Biological Interactions 248 (2016) 36e51
`
`37
`
`1. Introduction
`
`A number of biological interactions between ligands and re-
`ceptors mediate various vital metabolic pathways in the body.
`Since the interaction between a ligand and a biomarker or
`cellular receptor is highly specific, various biotechnologies have
`adopted the ligand-receptor affinity, including fluorescent label-
`ing applications; enzyme-linked immunosorbent assay (ELISA),
`immunoblotting, diagnosis kits, and fluorescence-based cancer
`imaging.
`In particular, many receptors specific to cancer cells or target
`molecules are present on cell surfaces and thus have been
`extensively employed for disease diagnosis and treatment [1]. The
`early diagnosis of cancer helps to ensure better prognosis of
`treatments. Various tools have been employed for cancer diag-
`nosis, including nuclear magnetic resonance (NMR), computed
`tomography (CT), positron emission tomography (PET), and
`single-photon emission computerized tomography (SPECT), and
`imaging
`imaging [2,3]. Among them, fluorescent
`fluorescent
`shows excellent potential as a diagnostic tool for in vitro and
`in vivo cellular monitoring because it is highly sensitive and se-
`lective and is inexpensive to handle. Specifically, the use of fluo-
`rophores targeted to cancer-specific ligands has been adopted for
`cancer diagnosis.
`Generally, there are three main strategies for treating cancer,
`surgery, radiotherapy, and chemotherapy. Among them, surgery is
`the most widely used cancer treatments. However, surgery has
`serious limitations in improving the survival rate of patients
`because the border between cancer and normal cells cannot be
`clearly discriminated by the naked eye. This challenge could result
`in the removal of healthy cells or residual cancerous tissue
`remaining. Recently, for improved outcomes, fluorescence-guided
`surgery has been widely employed in the treatment of cancer
`[4e6]. One of the greatest challenges in developing effective
`treatments for cancer is their obscure boundary which is from
`tissue invasion and metastasis. Differentiation of clear border of
`cancer tissue from normal tissue is necessary to prepare the
`promising cancer therapeutics [7,8].
`There have been numerous reviews focused on fluorescence-
`based cancer imaging [1,3,9]. Some mention various design
`schemes allowing for the use of fluorescent probes in medical
`diagnostic imaging via photoinduced electron transfer (PeT),
`F€orster resonance energy transfer (FRET), activation-quenching
`based fluorescent OFF-ON system, or fluorescent lifetime imaging
`(FLIM) strategies, which can be adopted for the development of
`fluorophores having high signal to background ratio [3,9]. A sepa-
`rate review outlines combinatorial strategies for the development
`of fluorescent probes through target or diversity-oriented fluores-
`cent libraries screening, powerful methods capable of identifying
`high potential fluorophores or ligands [10]. In addition, other re-
`views describe various synthesis and conjugation strategies for
`fluorophores and biomarker-specific ligands [11e14]. Gonçalves
`reviewed various types of organic fluorophores, with potential
`utility in the labeling of biomolecules. She introduced various
`research efforts for de novo construction of fluorophores according
`to emission wavelength; less than 500 nm, more than 500 nm, and
`NIR region [12].
`In this review, we summarize various factors for the designing
`conjugated molecules with cancer-specific fluorophores, specif-
`ically focusing on i) cancer-specific biomarkers, ii) biomarker spe-
`cific ligands, iii) fluorophores, and iv) conjugation of fluorophores
`and biomarkers from recent published literature (Fig. 1). The focus
`of this review is organic or organometallic fluorophore-conjugated
`systems (mainly organic molecules), not inorganic fluorophores,
`or quantum dots system.
`
`Fig. 1. Scheme for fluorescent imaging via conjugation between fluorophore and a
`cellular target-specific ligand.
`
`2. Requirements for fluorophore selection and fluorescence
`application techniques
`
`2.1. Factors impacting fluorophores selection
`
`A number of fluorochromes have been developed and applied to
`various topics including: i) chemical sensing, ii) cellular imaging, iii)
`protein labeling, iv) fluorescence analysis, and v) medicinal chem-
`istry (Fig. 2). When using fluorophores in biological systems, some
`key factors should be considered prior to their selection: i) wave-
`lengths of excitation and emission, ii) emission intensity, iii) solu-
`bility, and iv)
`stability. For
`the selection of fluorophores,
`consideration of excitation wavelength and emission wavelength is
`very important [15]. Although there are a variety of fluorophores
`display various emission wavelengths, from violet to red or NIR, a
`short wavelength (300 nm ~ 500 nm) can be disturbed by cyto-
`plasmic materials and penetration depth is not deep, meaning the
`influencing space is small. However, longer wavelength light, red or
`NIR, of fluorophores makes low interference with biological ma-
`terials and long depth penetration, which helps clear noninvasive
`cellular tumor imaging with high signal to background ratio [3].
`Strong emission signal is crucial for obtaining high signal to back-
`ground ratio. Intensity of emission depends on quantum yield un-
`der various solvents. Aqueous condition must be considered for
`selection of fluorophores because many organic fluorophores did
`not emit fluorescence in aqueous solution from the self-quenching
`by p-p stacking of resonance structure. For water solubility, sulfur
`oxide group can be inserted without disturbing photophysical
`properties of fluorophores [15].
`
`2.2. Synthesis of fluorophores
`
`Most fluorophores employed for bioimaging are usually com-
`mercial because they may be easy and convenient for handling.
`However, for the best use of fluorophores, de novo synthesis should
`be employed. The following articles are good sources of informa-
`tion about methods for the de novo synthesis of five main fluo-
`rophores; BODIPY [16], Rhodamine [17,18], Fluorescein [19e21],
`cyanine NIR fluorophores [22,23].
`
`2.3. Strategies for selective imaging with high signal to background
`ratio
`
`For the design of OFF-ON fluorescence probing systems, many
`strategies are employed especially, PeT, FRET, and FLIM, etc. [24].
`In particular, PeT is extensively used for the design of OFF-ON
`fluorescence detection. When one electron is transferred to the
`empty ground state from a nearby quenching ligand after excita-
`tion of a fluorophore, fluorescence is quenched (reductive PeT).
`However, after removing the quencher from the fluorophore-
`quencher conjugated molecules by lysosomes after uptake into
`cellular systems, selective high fluorescence can be generated [3].
`FRET is usually employed for
`the determination of
`three-
`dimensional (3D) structure of a protein, whose properties are
`
`

`

`38
`
`Y. Ha, H.-K. Choi / Chemico-Biological Interactions 248 (2016) 36e51
`
`Fig. 2. Various fluorescent molecules applied for cancer imaging.
`
`related to distance between two different fluorophores. Emission
`intensity decreases as the fluorophore's distance increases (1/r6).
`For cellular imaging, two fluorophores can be conjugated with two
`proteins which are capable of dimerization. According to the
`dimerization status of these proteins, two different fluorescent
`signals can be obtained, signals from monomer or dimer, which
`can provide important
`information related to distance and
`
`dimerization status of two proteins [25]. Relative to fluorescence
`imaging, FLIM shows different properties. FLIM signals depend on
`the time of fluorescence decay which is induced by micro-
`environmental changes, such as the composition and the func-
`tion of tissue, not by concentration of fluorophores, excitation
`intensity, and attenuation due to tissue absorption and scattering
`[26].
`
`

`

`Y. Ha, H.-K. Choi / Chemico-Biological Interactions 248 (2016) 36e51
`
`39
`
`2.4. Conjugation techniques between fluorophores and ligands
`
`For conjugation between fluorophores and biological materials,
`it will be useful to consider several connection strategies. Valuable
`information about fluorescent labeling techniques relating to bio-
`logical molecules (including proteins) are found in the literature
`[11,14]. In particular, Hermanson reviews a number of studies about
`conjugation properties between various functional groups [11].
`Conjugation strategies were described relating to main functional
`groups including amines, carboxylic acids, hydroxyls, and thiols
`(Figs. 3e6).
`Without specific activation, an amine group can be connected
`with various activated functional groups; isothiocyanate, isocya-
`nate, acyl azide, N-hydroxysuccinimide (NHS), sulfonyl chloride,
`aldehyde, epoxide, carbonate, fluorobenzene, and succinic anhy-
`dride (Fig. 3) [11,14]. In particular, isothiocyanate and NHS are
`widely employed as functional groups for targeting an amine
`group, e.g., Fluorescein isothiocyanate (FITC) [27], fluorophore-
`NHS-esters [28]. Aldehyde groups can also react with a primary
`amine to generate the Schiff base, which is transferred to a sec-
`ondary amine group after reduction. Interestingly, succinic anhy-
`dride can change the functional group of a molecule from primary
`amine to carboxylic acid, which may be helpful for more elaborate
`targeting situations.
`For carboxylate group, various activation groups are strongly
`required because of its stable resonance structure (Fig. 4) [11,14].
`Carbodiimide
`compounds,
`such
`as
`1-ethyl-3-(3-
`dimethylaminopropyl)carbodiimide (EDC), N,N0-Diisopropylcarbo-
`diimide (DIC), and N,N0-Dicyclohexylcarbodiimide (DCC) are widely
`used as activation compounds. In addition, carbonyl diimidazole
`(CDI), sulfo-NHS, and thionyl chloride can be useful for activation of
`the carboxylate group. After activation, various functional groups
`can be coupled with the carboxylate group, such as, primary
`amines, hydroxyls, and thiols to generate imide, ester, and thio
`ester compounds. Interestingly, diazoacetate can be connected with
`
`the carboxylic acid without activation.
`Hydroxyl groups also should be activated for coupling with
`various functional groups (Fig. 5) [11,14]. Similarly with the
`carboxylate group, EDC, DIC, DCC, and CDI, can be employed to
`activate the hydroxyl group. Additionally, tosyl chloride and N,N0-
`disuccinimidyl carbonate (DSC) are useful activators for hydroxyl
`groups. After activation, various nucleophiles can be conjugated to
`generate secondary amine, ether, sulfide, urethane, and imide
`compounds. Isocyanate can be directly linked to the hydroxyl group
`to induce a urethane moiety.
`Thiol groups can be useful as docking sites for various fluo-
`rophores in specific enzyme containing cysteine residues (Fig. 6)
`[11,14]. Maleimide derivatives, iodoacetyl compounds, aziridines,
`acryloyl derivatives, fluorobenzenes, and disulfide compounds are
`adopted to specific connection without specific activation (Fig. 6).
`In particular, a disulfide compound can be exchanged with one thiol
`group to generate an R-R0 combined molecule.
`
`3. Conjugation of specific ligands with fluorophores for
`diagnostic imaging of various tumors
`
`In this chapter, we describe the conjugation strategies of various
`organic fluorophores and biomarker-specific ligands presented in
`the literature for imaging of various cancers including lung cancer,
`breast cancer, pancreatic cancer, ovarian cancer, lymphoma, pros-
`tate cancer, other cancers, and cancer-related biological targets.
`
`3.1. Lung cancer
`
`Various biomarkers have been adopted for targeting and cellular
`imaging of lung cancers including aminophospholipids exposed,
`platelet/endothelial cell adhesion molecule 1 (PECAM 1) in tumor
`vasculature, and avb3 integrin, etc. (Table 1). As shown in Table 1,
`while one specific peptide ligand was applied only for imaging of
`H460 lung tumor cells, other ligands showed broad-spectrum
`
`Fig. 3. Conjugation strategies for an amine group with various functional groups [11].
`
`

`

`40
`
`Y. Ha, H.-K. Choi / Chemico-Biological Interactions 248 (2016) 36e51
`
`Fig. 4. Conjugation strategies for a carboxylate with various functional groups [11].
`
`Fig. 5. Conjugation strategies for a hydroxyl group with various functional groups [11].
`
`

`

`Y. Ha, H.-K. Choi / Chemico-Biological Interactions 248 (2016) 36e51
`
`41
`
`Fig. 6. Conjugation strategies for a thiol group with various functional groups [11].
`
`specificity. Proteins which have binding affinity to cancer-specific
`biomarkers were used for
`conjugation with fluorophores
`including annexin, endostatin, avidin, neomannosyl human serum
`albumin, and antibodies. While certain types of
`ligands are
`composed of peptides (cyclic RGD and CSNIDARAC peptide), the
`others were small molecules or drugs (folate and cisplatin). For the
`selection of fluorophores, commercial NIR dyes were usually
`adopted; Cy5, Cy5.5, Rhodamine X, Fluorescein, 3,6-bis(1-methyl-
`4-vinylpyridinium) carbazole diiodide (BMVC), and indocyanine
`green (ICG), while ZW800-1, and polythiophene were constructed
`with de novo synthetic methods.
`More specifically, Petrovsky et al. used fluorescence-imaging
`techniques for gliosarcoma and lung carcinoma [28]. Specifically,
`they were able to label the apoptotic process using an NIR probe
`based on Cy5.5 conjugated with annexin, a protein having a specific
`affinity for aminophospholipids externalized during apoptosis.
`The generation of blood vessels is critical during tumor pro-
`gression and many studies have been focused on developing in-
`hibitors of endostatin activity. Camphausen and colleges used a
`Cy5.5-based NIR probe attached to endostatin, a molecule which is
`involved in angiogenesis during tumor progression [29]. This group
`
`utilized endostatin for tumor imaging. They found endostatin-
`Cy5.5 homed at tumor vasculature and interacted with PECAM 1
`expression.
`It has been known that cRGD has binding affinity to the avb3
`integrin protein found on the cellular surface. Coll and colleagues
`employed a cyclic RGD peptide connected with Cy5 via cyclic
`decapeptide linker, called RAFT [30]. They tried to connect four
`cRGD ligands with a Cy 5 NIR dye covalently to view lung tumor
`cells. This approach increased targeting specificity. Also, Tseng et al.
`attempted to trace guanine-rich oligonucleotides (GROs), a thera-
`peutic target for tumors [31]. They used 3,6-bis(1-methyl-4-
`vinylpyridinium) carbazole diiodide (BMVC) or Cy5 as fluo-
`rophores and covalently linked these to two types of GROs, parallel
`and non-parallel G4 structures. They were able to monitor GROs'
`cellular uptake and movement in CL1-0 lung adenocarcinoma cells
`using fluorescent imaging via FRET. Also, Frangioni and research
`fellows presented an interesting report
`about
`an indo-
`tricarbocyanine (ITCC)-based NIR probe, ZW800-1 [35]. This probe,
`having innate zwitterionic property, was connected with cRGD
`peptide, fibrinogen or antibodies for use in in vitro, in vitro tumor
`imaging. For selective imaging of lung cancer, they adopted cRGD
`
`Table 1
`Conjugation of fluorophores and biomarker-specific ligands for bioimaging of lung cancer.
`
`Fluorophore
`
`Ligand
`
`Biomarker
`
`EX/EMa (nm/
`nm)
`
`Disease
`
`Ref
`
`635/710
`675/694
`633/
`
`Tumor apoptosis in Gliosarcoma and lung carcinoma [28]
`Lewis lung carcinoma tumor
`[29]
`human non small-cell lung carcinoma, human
`[30]
`ovarian cancer
`633/660e750 Lung cancer cell
`
`[31]
`
`Cy5.5
`Cy5.5
`Cy5
`
`Cy5
`
`BMVC
`
`Annexin
`Endostatin
`cRGD
`
`GRO
`
`GRO
`
`Avidin
`
`Rhodamine,
`QSY7
`Ab against HER2
`BODIPY
`CSNIDARAC peptide
`Fluorescein
`cRGD
`ZW800-1
`Polythiophene cisplatin
`
`Fluorescein
`
`folate
`
`Aminophospholipids externalized
`PECAM 1 in tumor vasculature
`avb3 integrin
`
`(to monitor intracellular movement of
`GROs)
`(to monitor intracellular movement of
`GROs)
`D-galactose receptor
`
`HER 2
`Surface receptor (Not specified)
`integrin avb3
`(to monitor intracellular movement of
`cisplatin)
`Folate receptor a
`
`ICG
`ICG
`
`Neomannosyl human serum albumin Mannose receptors on macrophages
`Serum albumin (non-covalently
`(Not specified)
`binding to ICG)
`
`a EX: Excitation wavelength, EM: Emission wavelength.
`
`633/660e750 Lung cancer cell
`
`metastatic lung tumors
`
`530e585/605
`e680
`480/500e800 Lung Tumor
`H460 lung tumor cells
`Liver, Lung tumor
`Adenocarcinomic human alveolar basal epithelial
`cells (A549 cell)
`lung adenocarcinomas (clinical study)
`
`e
`
`/800
`455/600
`
`465e490/520
`e530
`690e790/800 Sentinel Lymph Node in lung cancer (clinical study)
`690e790/800 Clinical stage I non-small-cell lung cancer (clinical
`study)
`
`[31]
`
`[32]
`
`[33]
`[34]
`[35]
`[36]
`
`[27]
`
`[37]
`[38]
`
`

`

`42
`
`Y. Ha, H.-K. Choi / Chemico-Biological Interactions 248 (2016) 36e51
`
`which is specific to the integrin protein avb3. They reported that
`this probe showed improvements over the commercial probes
`IRDye800-CW and Cy5.5.
`Kobayashi and colleges reported on the fluorescent detection of
`in vivo lung cancer metastases [32]. They employed a fluorophore-
`quencher modality for more specific detection, which means spe-
`cifically turn-ON when inside tumors and not outside or when in-
`side normal cells. They used an avidin protein which can bind to the
`D-galactose receptor to induce endocytosis and degradation in ly-
`sosomes. Disconnection of fluorophores from quenchers induced
`strong turn-ON emission selectively in the lung tumor. In addition,
`Kobayashi and his colleges also designed a targeted 'activatable'
`fluorescent imaging probe [33]. They conjugated a BODIPY fluo-
`rophore to an antibody, specific to human epidermal growth factor
`receptor type (HER) 2 protein. They designed BODIPY to turn-ON at
`the acidic pH found in lysosomes after internalization by the tumor
`cells. Therefore, they were able to probe lung cancer cells and tis-
`sues with high target-background signal.
`Lee and colleges reported an imaging probe with targeted de-
`livery ability using liposomal doxorubicin to lung tumor [34]. They
`employed a screening method of a phage-displayed peptide library.
`A CSNIDARAC peptide was highly effective to selective binding to
`H460 lung tumor cells. When doxorubicin was joined with the
`Fluorescein probe as liposomal type, it was successfully targeted to
`the lung cancer.
`Wang and colleges reported about an amphiphilic fluorophore
`conjugated with cisplatin which is a platinum-connected anti-
`cancer drug [36]. At first, they showed nontoxicity of polythiophene
`fluorophore, and tested the fluorophore for imaging lung tumor
`cells. This conjugated fluorophore-drug showed good potentiality
`of pharmacokinetics as an anticancer drug.
`Kim and colleagues performed fluorescence imaging on lung
`cancer using indocyanine green (ICG) NIR fluorophore linked to
`neomannosyl human serum albumin (MSA) in rat model [37].
`Relative to human serum albumin (HSA), MSA can easily be pene-
`trated into interstitial tissues to lymphatic capillaries, but not to
`blood capillaries, thus providing more specific binding to the
`mannose receptor on macrophages allowing for better tumor im-
`aging. Additionally, LD50 of ICG has been known as of 50e80 mg/kg
`for animals, and it can be excreted rapidly almost in the bile [39].
`As a clinical trial for lung cancer treatment, fluorescence imag-
`ing can be helpful for tumor surgery. Singhal and coworker re-
`ported intraoperative molecular imaging on lung adenocarcinomas
`from patients during pulmonary resection using fluorescein probe
`[27]. They connected the probe with a folate, folate-FITC, capable of
`binding specifically to the folate receptor a in the lung adenocar-
`cinoma. For toxicity information, they reported that there were not
`any severe toxicity relating to injection of folate-FITC, although one
`patient showed mild hives and another displayed some irritation at
`
`the injection site among a total of 50 patients, between ages 25 and
`85 years (mean: 67 years). Four hours before surgery, the folate-
`FITC conjugate (0.1 mg/kg) was administered intravenously. Dur-
`ing surgery, tumor fluorescence images were monitored in situ and
`ex vivo. Using this connected probe, they were able to successfully
`remove the tumor tissue during surgery.
`Yamashita group utilized ICG as a fluorophore for imaging non-
`small-cell lung cancers which were at clinical stage I [38]. Inter-
`estingly, no ligand was conjugated in targeting specific cellular
`materials They administered 2 mL of ICG (5 mg/ml) around the
`tumor and checked sentinel nodes after 10 min using video-
`assisted thoracoscopic imaging apparatus. They were able to
`identify sentinel nodes by NIR fluorescence imaging methods
`which were consistent well with the results from segmentectomy
`or lobectomy methods. The overall accuracy rate was 80.7%.
`
`3.2. Breast cancer
`
`Table 2 shows that proteins, small peptides, small organic
`molecules, and drugs have been used in the bioimaging of breast
`cancer. Protein ligands include epithermal growth factor (EGF),
`transferrin, and antibodies. Peptide ligands were specific enough
`for targeting proteins in breast cancer. In addition, small drugs were
`employed for imaging of specific enzymes for pharmacokinetic
`purposes.
`Overexpression of EGF receptor (EGFR) has been well known in
`various cancers of the brain, breast, colon, head, neck, lung, ovary,
`and pancreas and as such the EGF ligand has relatively broad-
`spectrum specificity for various cancers [40,41]. Li et al. reported
`an EGF-Cy5.5 conjugation optical probe [40]. They found that the
`EGF-Cy5.5 compound was well internalized in MDA-MB-468 breast
`cancer cells and mouse tissue to allow for strong fluorescent im-
`aging of cancers.
`Some experimental evidence indicates an interaction between
`interleukin (IL) 11 and interleukin 11 receptor alpha-chain (IL-11Ra)
`may be involved in thee metastasis of human breast cancer to the
`bone [42,43]. Wang et al. attempted to connect a cyclic peptide,
`c(CGRRAGGSC), to an IR-783-derived NIR fluorophore [44]. This
`cyclic peptide ligand has been known as a binding ligand for IL-
`11Ra. They successfully imaged breast cancer cells in mice models
`of breast cancer.
`It is known that glucose transporter (Glut) 5 tends to be over-
`expressed in tumors relative to normal tissue. Similarly, Gambhir
`and coworkers employed 7-nitro-1,2,3-benzadiazole (NBD) and
`Cy5.5 fluorophores for imaging breast cancer cells [45]. Interest-
`ingly, they used fructose, which can interact with a Glut5 as the
`ligand. The conjugated compounds fructose-Cy5.5 or fructose-NBD,
`showed internalization and emission of fluorescence in breast
`cancer cells. Also, Ramanujam and her colleges reported delivery-
`
`Table 2
`Conjugation of fluorophores and biomarker-specific ligands for bioimaging of breast cancer.
`
`Fluorophore
`
`Ligand
`
`Target
`
`EX/EM (nm/nm)
`
`Disease
`
`Cy5.5
`IR-783
`Cy5.5
`NBD
`Fluorescein
`NBD
`Cy5
`Cy5, Fluorescein
`AlexaFluor700, AlexaFluor750
`ZW800-1
`Cy5.5
`Texas Red
`Indigo Carmine dye þ ICG
`
`EGF
`c(CGRRAGGSC)
`Fructose
`Fructose
`trastuzumab
`glucose
`CLKADKAKC (CK3)
`LXL-1
`Transferrin
`antibody to the c-erbB-2 oncoprotein
`MT1-AF7p (HWKHLHNTKTFL)
`AZD2281
`(no specific ligand)
`
`EGFR
`IL-11RR
`Glut5
`Glut5
`HER2
`Glut
`NRP-1
`Specific sites in DNA
`Transferrin receptor
`c-erbB-2 oncoprotein
`MT1-MMP
`PARP 1
`(not specified)
`
`660/710
`785/830
`640/700
`450e490/515e565
`493/515
`470/520e620
`
`e
`
`e
`
`695/690e1020
`800
`675/695
`560/630
`760/380e1200
`
`Breast Cancer Xenografts
`Human breast cancer
`Breast cancer
`Breast cancer
`Breast cancer
`Murine Breast Cancer
`Breast cancer
`Metastatic Breast Cancer Cell
`Breast Cancer Cells
`Breast cancer cell
`Human breast carcinoma cell
`Human breast adenocarcinoma
`Early stage breast cancer (Clinical study)
`
`Ref
`
`[40]
`[44]
`[45]
`[45]
`[47]
`[46]
`[48]
`[49]
`[25]
`[35]
`[50]
`[51]
`[52]
`
`

`

`Y. Ha, H.-K. Choi / Chemico-Biological Interactions 248 (2016) 36e51
`
`43
`
`corrected imaging of breast cancer cells using fluorescently-labeled
`glucose targeting Glut on the surface of cancer cells [46]. They
`conjugated a NBD fluorophore to glucose, and used this to image
`breast cancer cells. They demonstrated the interaction of vascular
`oxygenation and differentiating metabolic phenotypes in vivo.
`In addition, DaCosta and colleagues applied trastuzumab, a dual
`labeled antibody conjugated to the fluorophore and quencher,
`Fluorescein and black hole quencher 3 (BHQ3), respectively [47].
`Trastuzumab has specific binding affinity to the HER 2 receptor on
`the surface of breast tumors. They demonstrated the feasibility of
`detecting tumor margins which in turn can effectively guide sur-
`geries using this conjugated probe.
`Zeng and coworkers reported their strategy of conjugating a
`small peptide to an NIR probe [48]. They screened phage libraries to
`find peptides which bind to breast cancer cells with high affinity,
`and sequenced these peptides. From this work they suggested that
`CLKADKAKC (CK3), which contains a cryptic C-end rule motif, binds
`to neuropilin-1, a multifunctional membrane receptor related with
`angiogenesis. They demonstrated that the peptide had excellent
`probing ability in breast cancer cells and mouse tissues with the
`conjugated NIR-CK3 molecule.
`Yang and coworkers employed the cell-based systematic evo-
`lution of ligands by exponential enrichment (SELEX) method to
`search an appropriate DNA-sequenced aptamer which exhibits
`selective probing ability for the breast cancer cell line, MDA-MB-
`231, which are derived from a metastatic site-pleural effusion
`[49]. They showed that a specific aptamer ligand, GAATTCAGTCG-
`GACAGCGAAGTAGTTTTCCTTCTAACCTAAGAACCCGCGGCAGTTTAAT
`GTAGATGGACGAATACGTCTCCC, which is named as LXL-1, showed
`good binding affinity. They conjugated this aptamer with a Cy5 NIR
`dye. This conjugated aptamer probe exhibited good imaging po-
`tential on metastatic breast cancer cell lines, not non-metastatic
`cells, with high selectivity.
`Also, Barroso et al. describe a method which can discriminate
`the bound and internalized transferrin from free and soluble
`transferrin using the NIR fluorescence lifetime FRET technique.
`Using AlexaFluor700 and AlexaFluor750 as fluorophores, each
`conjugated with transferrin, they were able to detect bound and
`internalized forms of transferrin in breast cancer cells and tumors
`using animal models.
`Chen and fellows screened Ph.D.-12™ phage display peptide
`libraries to find appropriate ligands for targeting membrane type-1
`matrix metalloproteinase (MT1-MMP) which has been known to
`inhibit pericellular proteolysis of extracellular