METHOD FOR DIAGNOSING AND MONITORING INFLAMMATORY DISEASE
`
`PROGRESSION
`
`Patent Application
`Atty. Docket No. GWLG-Ol7US-CIP
`
`Priority Claims and Related Patent Applications
`
`[0001]
`
`This application is a continuation-in-part of and claims the benefit of priority to
`
`US Utility Application Serial No. 15/094,086, filed April 8, 2016, which claims the benefit of
`
`priority, under 35 U.S.C. §120, from the US designation of International Application No.
`
`PCT/CA2014/000742, filed on Oct. 10, 2014, which claims benefit of priority from US
`
`Provisional Application Serial No. 61/889,085, filed on Oct. 10, 2013, the entire content of each
`
`of which is incorporated herein by reference in its entirety for all purposes.
`
`Field of the Invention
`
`[0002]
`
`The present invention provides compositions and/or methods for diagnosis or
`
`assessment of progression of inflammatory diseases, in particular, endometriosis.
`
`Background of the Invention
`
`[0003]
`
`Neurotrophins are a family of soluble, small molecular weight proteins that act in
`
`the nervous system to promote neuronal development, differentiation, growth, and maintenance.
`
`The neurotrophin signalling network is complex. Neurotrophins can be translated as pro-proteins
`
`and cleaved into their active forms, or they can induce signalling cascades in their pro- form.
`
`Generally, the two forms have opposing functions. The neurotrophin family comprises four
`
`ligands, brain-derived neurotrophic factor (BDNF), nerve growth factor (NGF), neurotrophin 3
`
`(NTF3), and neurotrophin 4 (NTF4), and four receptors: neurotrophic tyrosine receptor kinase
`
`(NTRK) 1, NTRK2, NTRK3, and the nerve growth factor receptor (NGFR). Although all four
`
`neurotrophins bind to NGFR with similar affinities, and their pro-protein forms have been shown
`
`to bind to this receptor as well, they are more selective in binding the NTRKs. NGF binds to
`
`NTRKl, BDNF and NTF4 bind to NTRK2, and NTF3 binds to NTRK3, each with high affinity.
`
`Another lesser known neurotrophin co-receptor, sortilin (SORTl), has been shown to interact
`
`with pro-neurotrophins in the brain and to control their release in either a constituent or activity-
`
`dependent manner. SORTl
`
`is also involved in an elaborate intracellular trafficking network
`
`directing proteins to various fates: cell surface expression, secretion, endocytosis, or transport
`
`1
`
`SUBSTITUTE
`
`

`

`Patent Application
`Atty. Docket No. GWLG-Ol7US-CIP
`
`within the cell. However, the regulation and expression of this complex signalling network in the
`
`uterus remains unexplored.
`
`[0004]
`
`Although mainly recognized for their supportive function within the nervous
`
`system, BDNF and its high affinity receptor NTRK2 have been shown to participate in ovarian
`
`development, follicular development, oocyte survival, endometrial stem cell neurogenesis, and
`
`normal placental development. The interaction between BDNF and NTRK2 is not only capable
`
`of inducing neuronal development, differentiation, growth, and maintenance, activation of the
`
`BDNF-NTRK2 pathway has been demonstrated to induce angiogenesis, cellular proliferation,
`
`adhesion, and resistance to apoptosis. Each of these pathways is inextricably linked to
`
`reproduction, however the mechanisms regulating the uterine expression of BDNF, NTRK2,
`
`NGFR, and SORTl remain unknown.
`
`[0005]
`
`Thus, it would be desirable to better understand neurotrophin regulation in the
`
`mammalian uterus, and to develop methods to recognize one or more pathologies associated with
`
`a neurotrophin.
`
`Summary of the Invention
`
`[0006]
`
`It has now been determined that elevated expression levels of BDNF combined
`
`with one or more additional biomarkers, such as full-length Ntrk2 receptor, glycodelin and
`
`optionally, zinc-alpha-Z-glycoprotein (ZAG), in a biological sample from a mammal is indicative
`
`of endometriosis.
`
`[0007]
`
`Thus,
`
`in one aspect, a method of diagnosing endometriosis in a mammal
`
`is
`
`provided comprising the steps of: determining the expression level of BDNF in a biological
`
`sample from the mammal and comparing the BDNF level to a control BDNF level, determining
`
`the expression level of full-length Ntrk2 in the biological sample and comparing the Ntrk2 level
`
`to a control Ntrk2 level, and diagnosing the mammal with endometriosis when the BDNF level
`
`and Ntrk2 level are both elevated by at least 10% as compared with the control levels.
`
`[0008]
`
`In another aspect, a method of diagnosing endometriosis in a mammal is provided
`
`comprising the steps of: determining the expression levels of BDNF, glycodelin, and optionally
`
`ZAG,
`
`in a biological sample from the mammal and comparing the level of each to a pre-
`
`2
`
`SUBSTITUTE
`
`

`

`Patent Application
`Atty. Docket No. GWLG-017US-CIP
`
`determined level associated with endometriosis, and diagnosing the mammal with endometriosis
`
`when the levels of BDNF, glycodelin and optionally ZAG are each elevated to the predetermined
`
`level associated with endometriosis.
`
`[0009]
`
`In another aspect, a method of monitoring a mammal following treatment for
`
`endometriosis is provided comprising: determining the expression level of a biomarker selected
`
`from BDNF, or glycodelin in a biological sample from the mammal, comparing the biomarker
`
`level to a pre-treatment level, and determining that the mammal is responding to treatment if the
`
`biomarker level is reduced by at least 10% as compared to the pretreatment biomarker level.
`
`[0010]
`
`In a further aspect of the invention, a kit is provided comprising a BDNF-specific
`
`reactant and i) a glycodelin-specific reactant and optionally a ZAG—specific reactant, or ii) a full-
`
`length Ntrk2-specif1c reactant, and further optionally, instructions for use to detect endometriosis
`
`in a mammal.
`
`[0011]
`
`In a further aspect, a method of diagnosing inflammatory disease in a mammal is
`
`provided. The method comprises determining the expression level of BDNF in a biological
`
`sample from the mammal and comparing the BDNF level to a control BDNF level to determine
`
`if the BDNF level is elevated in comparison to the BDNF baseline level, wherein an elevated
`
`BDNF level is indicative of inflammatory disease in the mammal.
`
`[0012]
`
`These and other aspects of the invention are described herein by reference to the
`
`description and figures as follows.
`
`Brief Description of the Figures
`
`[0013]
`
`Figure 1 graphically illustrates that circulating concentration of BDNF is higher
`
`in the plasma of women with endometriosis vs. a control population,
`
`[0014]
`
`Figure 2 graphically illustrates that
`
`total plasma BDNF concentration is
`
`significantly higher in women at any stage of endometriosis vs. controls,
`
`[0015]
`
`Figure 3 graphically demonstrates that plasma total BDNF concentration is
`
`similar across the menstrual cycle,
`
`3
`
`SUBSTITUTE
`
`

`

`Patent Application
`Atty. Docket No. GWLG-Ol7US-CIP
`
`[0016]
`
`Figure 4 compares plasma BDNF concentration in women with endometriosis
`
`prior to treatment (untreated), and sub sequent to treatment (treated);
`
`[0017]
`
`Figure 5 illustrates the relationship between plasma BDNF concentrations and
`
`pain scores in mammals with untreated endometriosis,
`
`[0018]
`
`Figure 6 shows the results of Western blot analysis of human endometrium from
`
`healthy women illustrating that pro-BDNF is the dominant form present (A), and that truncated
`
`Ntrk2 is the dominant isoform present (B),
`
`[0019]
`
`Figure 7 shows a Western blot analysis of endometrium obtained from women
`
`with endometriosis vs. healthy controls showing that the full-length (FL) variant of Ntrk2 is
`
`overexpressed in endometriosis,
`
`[0020]
`
`Figure 8 illustrates BDNF transcript expression in the murine uterus in mice
`
`receiving saline (Control (n=4)), estradiol primed then estradiol (E2 (n=6)), estradiol primed then
`
`progesterone (P4 (n=6)), estradiol primed then estradiol + progesterone (E2 + P4 (n=6)), or
`
`estradiol primed then saline (Saline (n=4)),
`
`[0021]
`
`Figure 9 illustrates the amino acid sequences of human (A), mouse (B) and rat
`
`(C) mBDNF, and of human (D), mouse (E) and rat (F) full-length Ntrk2,
`
`[0022]
`
`Figure 10 illustrates the nucleic acid sequence of human (A),mouse (B) and rat
`
`(C) BDNF transcripts, and human (D), mouse (E) and rat(F) Ntrk2 transcripts,
`
`[0023]
`
`Figure 11 illustrates circulating concentrations of ZAG, glycodelin, BDNF, and
`
`CA-125 between untreated cases
`
`(n=35-60) and controls
`
`(n=12-26) with ROC curves.
`
`Circulating glycodelin (A) was significantly elevated (p=0.041) in untreated cases compared to
`
`controls. Circulating ZAG (B) tended to be elevated (p=0.086) in untreated cases compared to
`
`controls. Circulating BDNF (C) was significantly higher (p=0.0008) in untreated cases compared
`
`to controls while circulating concentrations of CA125 (D) did not reach statistical significance
`
`(p=0.626). Glycodelin, ZAG, BDNF, and CA-125 produced ROC curves with an AUC of 0.70
`
`(p=0.040), 0.66 (p=0.085), 0.73 (p<0.001), and 0.47 (p=0.622),
`
`respectively. Statistically
`
`significant differences are denoted by an asterisk (*) above the graph (* p<0.05, *** p<0.001).
`
`4
`
`SUBSTITUTE
`
`

`

`Patent Application
`Atty. Docket No. GWLG-Ol7US-CIP
`
`Sensitivity vs specificity plots are provided in (E). Whiskers on the box plots represent the 5th
`
`and 95th percentiles, while the lower limit of the box lower quartile and the upper limit is the
`
`upper quartile. The line within the box is the median of the data. Normally distributed data are
`
`portrayed as an aligned dot plot with error bars representing standard deviation from the mean;
`
`[0024]
`
`Figure 12 illustrates that a biomarker decision tree utilizing default CART
`
`analysis parameters achieves a sensitivity of 76.9% and a specificity of 93.3%. Parent nodes are
`
`outlined by bold blue rectangles and terminal nodes are outlined by red rectangles. The class
`
`assignment of patients in each node is shown under the node number. Class 0 is the control
`
`group, and class 1
`
`is the endometriosis group. Bars give a graphical representation of the
`
`proportion of patients from each group assigned to that node. Splitting variables are shown above
`
`a node, with the cut-off value for the split shown above the child node in gray. N=number of
`
`study participants;
`
`[0025]
`
`Figure 13 illustrates that a biomarker decision tree utilizing CART analysis
`
`parameters optimized for sensitivity achieves a sensitivity of 89.2% and a specificity of 70.0%.
`
`Parent nodes are outlined by bold blue rectangles and terminal nodes are outlined by red
`
`rectangles. The class assignment of patients in each node is shown under the node number. Class
`
`0 is the control group, and class
`
`1
`
`is the endometriosis group. Bars give a graphical
`
`representation of the proportion of patients from each group assigned to that node. Splitting
`
`variables are shown above a node, with the cut-off value for the split shown above the child node
`
`in gray. N=number of study participants,
`
`[0026]
`
`Figure 14 illustrates the amino acid sequences of human isoforms of glycodelin
`
`(A, B and C), and human transcript variants of human glycodelin (D, E and F), and
`
`[0027]
`
`Figure 15 illustrates the amino acid sequences of human (A) and mouse (B)
`
`ZAG, and mRNA sequences of human (C) and mouse (D) ZAG.
`
`[0028]
`
`Figure 16 is a schematic illustrating: a) APTES (3-aminopropyltiriethoxysilane)
`
`treated polystyrene (PS) substrate with porous gold immobilization surface, b) thiol bonding
`
`immobilizes
`
`the primary linker cystamine followed by an easily reactive
`
`secondary
`
`glutaraldehyde linker to create a self-assembled monolayer of aldehyde groups, c) anti-BDNF
`
`5
`
`SUBSTITUTE
`
`

`

`Patent Application
`Atty. Docket No. GWLG-Ol7US-CIP
`
`(Brain Derived Neurotrophic Factor) monoclonal antibody (mAb) is immobilized via the
`
`secondary linker to assemble the electrochemical detection device; d) unreacted aldehyde groups
`
`are blocked using 5 % (w/v) Bovine Serum Albumin (BSA); e) the target analyte; BDNF protein,
`
`will
`
`attach to its mAb;
`
`and the redox reporter
`
`system of
`
`[Fe(CN)6]3'/4'
`
`is used to
`
`electrochemically detect the presence of protein; and f) Differential Pulse Voltammetry graph
`
`illustrating how the binding of BDNF to the antibody inhibits the interfacial electron transfer
`
`reaction to take place therefore decreasing current signal.
`
`[0029]
`
`Figure 17 graphically compares the sensitivities of planar (grey bar) and porous
`
`(black bar) immunosensors when a concentration of 1 ng/mL BDNF in PBS is used.
`
`[0030]
`
`Figure 18 graphically illustrates
`
`the detection limit of
`
`sensors
`
`in
`
`a
`
`electrochemical solution of 2.5 mM [Fe(CN)6]3'/4' with various concentrations of BDNF in PBS.
`
`[0031]
`
`Figure 19 illustrates differential pulse voltammograms that show the difference in
`
`electrochemical signal before and after the addition of target analyte at various concentrations.
`
`6
`
`SUBSTITUTE
`
`

`

`Patent Application
`Atty. Docket No. GWLG-Ol7US-CIP
`
`Detailed Description of the Invention
`
`[0032]
`
`In one aspect, a method of diagnosing endometriosis in a mammal is provided
`
`comprising the steps of: determining the expression level of BDNF in a biological sample
`
`from the mammal and comparing the level to a control BDNF baseline level; determining the
`
`expression level of full-length Ntrk2 in the biological sample from the mammal and
`
`comparing the Ntrk2 level to a control Ntrk2 baseline level; diagnosing the mammal with
`
`endometriosis when the BDNF level and Ntrk2 level are both elevated by at least 10% as
`
`compared with their baseline levels.
`
`[0033]
`
`In another aspect, a method of diagnosing endometriosis in a mammal
`
`is
`
`provided comprising the steps of: determining the expression levels of BDNF, glycodelin, and
`
`optionally ZAG, in a biological sample from the mammal and comparing the level of each to
`
`a pre-determined level associated with endometriosis, and diagnosing the mammal with
`
`endometriosis when the levels of BDNF, glycodelin and optionally ZAG are each elevated to
`
`the predetermined level associated with endometriosis.
`
`[0034]
`
`Brain-derived neurotrophic factor, referred to herein as BDNF, is a secreted
`
`protein that supports growth and survival of neurons. As used herein, BDNF encompasses
`
`mammalian BDNF,
`
`including human and functionally equivalent variants thereof such as
`
`non-human BDNF, and isoforms or other variants of human and non-human BDNF, including
`
`pro-BDNF and mBDNF. Functionally equivalent BDNF variants are variants that incorporate
`
`alterations, such as, but not limited to, amino acid deletions, additions or substitutions, which
`
`do not significantly adversely affect BDNF activity. Post-translationally modifled BNDF is
`
`referred to as mature BDNF or mBDNF. Amino acid sequences for mBDNF are known and
`
`readily accessible at sequence databases, such as GenBank, by reference to nucleotide
`
`accession nos, e.g. human mBDNF (accession no. KC855559), mouse mBDNF (accession
`
`no. KC855560),
`
`rat mBDNF (accession no. KC855561), pig mBDNF (accession no.
`
`KC855563) and horse mBDNF (accession no. KC855562). mBDNF amino acid sequences
`
`are illustrated in Fig. 9, and nucleic acid encoding sequences are shown in Fig. 10.
`
`7
`
`SUBSTITUTE
`
`

`

`Patent Application
`Atty. Docket No. GWLG-Ol7US-CIP
`
`[0035]
`
`Neurotrophic tyrosine kinase, receptor, type 2 (Ntrk2), also known as TrkB
`
`receptor, TrkB tyrosine kinase or BDNF/NT-3 growth factor receptor, is a BDNF receptor.
`
`As used herein, Ntrk2 encompasses full-length mammalian Ntrk2,
`
`including human and
`
`functionally equivalent variants thereof such as non-human Ntrk2. Functionally equivalent
`
`variants of full-length Ntrk2 encompass full-length Ntrk2 which may incorporate alterations,
`
`such as, but not limited to, minor amino acid alternations such as deletions, additions or
`
`substitutions, e. g. involving 1 or 2 amino acid residues, which do not significantly adversely
`
`affect Ntrk2 activity, such as BDNF binding.
`
`Amino acid sequences of various forms of
`
`full-length Ntrk2 are known and readily accessible at sequence databases, such as GenBank,
`
`by reference to nucleotide accession nos, e.g. human Ntrk2 (KC855566), mouse Ntrk2
`
`(KC855567),
`
`rat Ntrk2 (KC855568) and horse Ntrk2 (KC855569). Ntkr2 amino acid
`
`sequences are illustrated in Fig. 9, and nucleic acid encoding sequences are shown in Fig. 10.
`
`[0036]
`
`Glycodelin, also known as progestagen-associated endometrial protein (PAEP)
`
`or pregnancy-associated endometrial alpha-2 globulin, is a protein that in humans is encoded
`
`by the PAEP gene. As used herein, glycodelin encompasses mammalian glycodelin,
`
`including human and functionally equivalent variants thereof such as non-human glycodelin,
`
`and isoforms or other variants of human and non-human glycodelin, which essentially retain
`
`the function of the parent protein. Functionally equivalent glycodelin variants are variants
`
`that incorporate alterations, such as, but not limited to, amino acid deletions, additions or
`
`substitutions, which do not significantly adversely affect activity. Amino acid sequences for
`
`glycodelin are known and readily accessible on sequence databases, such as NCBI, by
`
`reference to accession nos. e. g. human glycodelin (accession no. NP_001018058 (Isoform 2
`
`precursor), and NP_001018059 (isoform 1 precursor)), as shown in Fig. 14A, as well as
`
`nucleotide sequences, transcript variants l and 2, which encode isoform 1, and transcript
`
`variant 3 which encodes isoform 2 (accession nos. NM_001018049, NM_002571 and
`
`NM_001018048, respectively) as shown in Fig. 14B.
`
`[0037]
`
`Zinc-alpha-2-glycoprotein (ZAG) is a protein that in humans is encoded by the
`
`AZGPl gene. As used herein, ZAG encompasses full-length mammalian ZAG, including
`
`8
`
`SUBSTITUTE
`
`

`

`Patent Application
`Atty. Docket No. GWLG-Ol7US-CIP
`
`human and functionally equivalent variants thereof such as non-human ZAG. Functionally
`
`equivalent variants of full-length ZAG encompass full-length Ntrk2 which may incorporate
`
`alterations, such as, but not limited to, minor amino acid alternations such as deletions,
`
`additions or substitutions, e.g.
`
`involving 1 or 2 amino acid residues, which do not
`
`significantly adversely affect Ntrk2 activity, such as BDNF binding. Amino acid sequences
`
`of various forms of ZAG are known and readily accessible from sequence databases, such as
`
`NCBI, by reference to accession nos, e.g. human ZAG (NP_OOll76) and mouse ZAG
`
`(NP_03 8506), as well as transcript sequences for human ZAG (NM_001185) and mouse ZAG
`
`(NM_013478) as shown in Fig. 15.
`
`[0038]
`
`To conduct the present method, a suitable biological sample(s) is obtained
`
`from a female mammal.
`
`The term “biological
`
`sample” is meant
`
`to encompass any
`
`mammalian fluid or tissue sample that may contain nucleic acid encoding a target biomarker
`
`gene, or that may contain the target biomarker protein (such as BDNF, Ntrk2, glycodelin
`
`and/or ZAG protein or nucleic acid). Suitable biological samples include, for example, blood
`
`(including menses), serum, plasma, urine, peritoneal fluid or biopsied endometrial tissue.
`
`Any of these samples may be obtained from the mammal in a manner well-established in the
`
`art.
`
`The term “mammal” is used herein to refer to both human and non-human mammals
`
`including domestic animals, e.g. cats, dogs and the like,
`
`livestock and undomesticated
`
`animals.
`
`[0039]
`
`Once a suitable biomarker-containing biological sample is obtained,
`
`it
`
`is
`
`analyzed to determine the expression level of selected biomarkers in the sample, either at the
`
`transcript level or protein level. As one of skill in the art will appreciate, the expression level
`
`of each biomarker may be determined using one of several techniques established in the art,
`
`including methods of quantifying nucleic acid encoding the target biomarker, such as PCR-
`
`based techniques, microarrays, gene expression system, and Northern or Southern blotting
`
`techniques, or methods of quantifying protein biomarker, such as immunological or activity
`
`assay, Western blotting, or mass spectrometry. With respect to BDNF, it is the level of
`
`mBDNF that is related to endometriosis, however,
`
`total BDNF does reflect changes in
`
`9
`
`SUBSTITUTE
`
`

`

`Patent Application
`Atty. Docket No. GWLG-Ol7US-CIP
`
`mBDNF. Thus, depending on the biological sample used, either the expression level of total
`
`BDNF may be determined, or, if possible in the sample obtained, the expression level of
`
`mBDNF may be specifically determined.
`
`[0040]
`
`In one embodiment, the expression levels of biomarkers (e.g. BDNF, Ntrk2,
`
`glycodelin or ZAG) in a biological sample from a mammal may be determined based on the
`
`levels of nucleic acid (i.e. DNA or mRNA transcript) encoding the target protein biomarker in
`
`the biological sample. Methods of determining DNA or mRNA levels are known in the art,
`
`and include, for example, PCR—based techniques (such as RT-PCR), and Northern or Southern
`
`blotting techniques which generally include the application of gel electrophoresis to isolate
`
`the target nucleic acid, followed by hybridization with specific labeled probes. Probes for use
`
`in these methods can be readily designed based on the known sequences of genes encoding
`
`the protein biomarker, as well as the known amino acid sequence of the target biomarker, and
`
`may comprise about 15-40 nucleotides, for example, 20-35 nucleotides. Probes that target
`
`mBDNF are generally suitable for use in the present method. Such probes would detect total
`
`BDNF in a sample. For Ntrk2, probes that target full-length Nkrt2 are generally suitable to
`
`detect Ntrk2.
`
`Examples of BDNF probes
`
`include GAGCTGAGCGTGTGTGACAG
`
`(forward) (SEQ ID NO: 9) and CTTATGAATCGCCAGCCAAT (reverse) (SEQ ID NO: 10),
`
`and examples of Ntrk2 probes include CAATTGTGGTTTGCCATCTG (forward) (SEQ ID
`
`NO: 11) and TGCAAAATGCACAGTGAGGT (reverse) (SEQ ID NO: 12). Suitable labels
`
`for use are well-known, and include,
`
`for example,
`
`fluorescent, chemiluminescent and
`
`radioactive labels. Probes for glycodelin and ZAG may readily be determined based on their
`
`known gene sequences, including the mRNA sequences provided herein.
`
`[0041]
`
`A preferred assay method to measure biomarker transcript abundance includes
`
`using the NanoString nCounter gene expression system. The system utilizes a pair of probes,
`
`namely, a capture probe and a reporter probe, each comprising a 35- to 50-base sequence
`
`complementary to the biomarker transcript. The capture probe additionally includes a short
`
`common sequence coupled to an immobilization tag, e.g. an affinity tag that allows the
`
`complex to be immobilized for data. collection. The reporter probe additionally includes a
`
`10
`
`SUBSTITUTE
`
`

`

`Patent Application
`Atty. Docket No. GWLG-Ol7US-CIP
`
`detectable signal or label, e.g.
`
`is coupled to a color-coded tag. Following hybridization,
`
`excess probes are removed from the sample, and hybridized probe/target complexes are
`
`aligned and immobilized via the affinity or Other tag in a cartridge. The samples are then
`
`analyzed, for example using a digital analyzer or other processor adapted for this purpose.
`
`Generally, the color~coded tag on each transcript is counted and tabulated for each target
`
`transcript to yield the expression level of each transcript on the sample.
`
`[0042]
`
`In other embodiments, the expression level of protein, mBDNF, full-length
`
`Ntrk2, glycodelin or ZAG, in a sample may be measured by immunoassay using an antibody
`
`specific to the target protein. As above, the antibody is bound to the target protein and bound
`
`antibody is quantified by measuring a detectable marker which may be linked to the antibody
`
`or other component of the assay, or which may be generated during the assay. Detectable
`
`markers may include radioactive,
`
`fluorescent, phosphorescent and luminescent
`
`(e. g.
`
`chemiluminescent or bioluminescent) compounds, dyes, particles such as colloidal gold and
`
`enzyme labels.
`
`[0043]
`
`The term “antibody” is used herein to refer to monoclonal or polyclonal
`
`antibodies, or antigen-binding fragments thereof, e.g. an antibody fragment
`
`that retains
`
`specific binding affinity for the target biomarker. Antibodies to the target biomarkers are
`
`generally commercially available. For example, BDNF antibodies to various BDNF
`
`immunogens,
`
`including internal, and N— and C- terminal, are commercially available, for
`
`example,
`
`from Sigma Alderich, Santa Cruz Biotechnology and AbCam, while Nkrt2
`
`antibodies are commercially available from, for example, AbCam, R&D Systems and Origene
`
`Technologies. Antibodies targeting glycodelin and ZAG are similarly commercially available
`
`from AbCam, LifeSpan BioSciences, R&D Systems, Santa Cruz Biotechnology and others.
`
`As one of skill in the art will appreciate, antibodies to the target proteins may also be raised
`
`using techniques conventional in the art. For example, antibodies may be made by injecting a
`
`host animal, e. g. a mouse or rabbit, with the antigen (target protein or immunogenic fragment
`
`thereof), and then isolating antibody from a biological sample taken from the host animal.
`
`11
`
`SUBSTITUTE
`
`

`

`Patent Application
`Atty. Docket No. GWLG-Ol7US-CIP
`
`[0044]
`
`Different types of immunoassay may be used to determine the expression level
`
`of target proteins, including indirect immunoassay in which the protein is non-specifically
`
`immobilized on a surface; sandwich immunoassay in which the protein is specifically
`
`immobilized on a surface by linkage to a capture antibody bound to the surface; competitive
`
`binding immunoassay in which a sample is first combined with a known quantity of antibody
`
`to bind the target protein in the sample, and then the sample is exposed to immobilized target
`
`protein which competes with the sample to bind any unbound antibody. To the immobilized
`
`protein/antibody is added a detectably-labeled secondary antibody that detects the amount of
`
`immobilized primary antibody, thereby revealing the inverse of the amount of target protein
`
`in the sample.
`
`[0045]
`
`A preferred immunoassay for use to determine expression levels of target
`
`protein in a sample is an ELISA (Enzyme Linked ImmunoSorbent Assay) or Enzyme
`
`ImmunoAssay (EIA). To determine the level or concentration of the target protein using
`
`ELISA, the target to be analyzed is generally immobilized, for example, on a solid adherent
`
`support, such as a microtiter plate, polystyrene beads, nitrocellulose, cellulose acetate, glass
`
`fibers and other suitable porous polymers, which is pretreated with an appropriate ligand for
`
`the target, and then complexed with a specific reactant or ligand such as an antibody which is
`
`itself linked (either before or following formation of the complex) to an indicator, such as an
`
`enzyme. Detection may then be accomplished by incubating this enzyme-complex with a
`
`substrate for the enzyme that yields a detectable product. The indicator may be linked
`
`directly to the reactant (e. g. antibody) or may be linked via another entity, such as a secondary
`
`antibody that recognizes the first or primary antibody. Alternatively, the linker may be a
`
`protein such as streptavidin if the primary antibody is biotin-labeled. Examples of suitable
`
`enzymes for use as an indicator include, but are not limited to, horseradish peroxidase (HRP),
`
`alkaline phosphatase (AP), B-galactosidase, acetylcholinesterase and catalase. A large
`
`selection of substrates is available for performing the ELISA with these indicator enzymes.
`
`As one of skill in the art will appreciate, the substrate will vary with the enzyme utilized.
`
`Useful
`
`substrates also depend on the level of detection required and the detection
`
`12
`
`SUBSTITUTE
`
`

`

`Patent Application
`Atty. Docket No. GWLG-Ol7US-CIP
`
`instrumentation used, e.g. spectrophotometer, fluorometer or luminometer. Substrates for
`
`HRP include 3,3’,5,5’-Tetramethylbenzidine (TlVfl3), 3,3'—Diaminobenzidine (DAB) and 2,2'—
`
`azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS). Substrates for AP include 1%
`
`Nitrophenylphosphates. Substrates for B-galactosidase include lfi-galactosides, the substrate
`
`for acetylcholinesterase is acetylcholine, and the substrate for catalase is hydrogen peroxide.
`
`[0046]
`
`As will be appreciated by one of skill in the art, assay methods which target the
`
`activity of a target protein may also be utilized to determine the expression level thereof in a
`
`sample. In this regard, suitable assays would be known to the skilled person, including for
`
`example, an mBDNF-Nkrt2 binding assay.
`
`[0047]
`
`The expression level of the selected biomarkers mBDNF and Nkrt2, or
`
`mBDNF, glycodelin and optionally ZAG, in a given sample may be analyzed individually or
`
`together using, for example, biochip array technology. Generally, biochip arrays provide a
`
`means to simultaneously determine the level of multiple biomarkers in a given sample. These
`
`arrays may utilize ELISA technology and, thus, the biochip may be modified to incorporate
`
`capture antibodies for each target at pre-defmed sites on the surface.
`
`[0048]
`
`Once the expression level of selected biomarkers in a biological sample of a
`
`mammal has been determined, these expression levels are compared to control expression
`
`levels,
`
`i.e. the expression level of selected biomarkers from BDNF, Ntrk2, glycodelin and
`
`ZAG, in a healthy control, i.e. a mammal that does not have endometriosis. Alternatively, the
`
`level of the selected biomarkers may be compared to the expression level of a “housekeeping
`
`gene”. The term “housekeeping gene” as used herein is meant to refer to a gene that encodes
`
`a protein product that is not connected to, involved in or required for processes specific to
`
`endometriosis, and thus, exhibits a fixed expression level
`
`in mammals with and without
`
`endometriosis. Examples of suitable housekeeping genes include, but are not limited to,
`
`genes encoding ACTB (Beta-actin), GAPDH (Glyceraldehyde 3-phosphate dehydrogenase),
`
`RPLPO (60S acidic ribosomal protein PO), GUSB (beta-glucuronidase),
`
`and TFRC
`
`(transferring receptor 1).
`
`In a comparison of the expression levels of target biomarkers to
`
`13
`
`SUBSTITUTE
`
`

`

`Patent Application
`Atty. Docket No. GWLG-Ol7US-CIP
`
`housekeeping genes, a determination of an increase in transcript abundance or expression of
`
`the selected biomarker
`
`relative to that of the housekeeping gene is
`
`indicative of
`
`endometriosis.
`
`[0049]
`
`The level of expression (or concentration)
`
`that would be considered to
`
`represent an increased or elevated expression level of the selected biomarkers that
`
`is
`
`associated with endometriosis in accordance with the present method may be determined
`
`relative to levels of biomarker in a healthy control sample, or relative to the expression of one
`
`or more housekeeping genes.
`
`In one embodiment, a reproduceable statistically significant
`
`increase in the expression of a biomarker, for example, an increase of at least about 5%,
`
`preferably, at least about 10%, 20%, 30%, 40% or 50% or greater,
`
`in comparison to the
`
`expression levels in a control, or in comparison to the expression level of a housekeeping
`
`gene, is considered to be elevated expression that is relevant with respect to a diagnosis of
`
`endometriosis. Generally, a plasma BDNF level
`
`in the range of about 100-500 pg/ml is
`
`considered to be normal, while plasma BDNF levels higher than this, e. g. by about 10-50% or
`
`greater, are indicative of endometriosis, e.g. for example, plasma BDNF levels of 800 pg/ml
`
`or greater are indicative of endometriosis. Generally, serum concentrations of glycodelin in
`
`the range of
`
`5 to 31 ng/ml is considered to be normal, and concentrations greater than 39
`
`ng/ml are considered to be indicative of endometriosis. For ZAG, circulating concentrations
`
`in the range of 41to 65 pg/ml are regarded as normal, while serum concentrations greater than
`
`92 pg/ml are considered to be indicative of endometriosis. As one of skill in the art will
`
`appreciate, the difference in the level of biomarker expression as compared to expression of
`
`the housekeeping gene(s) may vary with the methodology employed to quantify and analyze
`
`nucleic acid and/or protein expression.
`
`[0050]
`
`The present invention also provides a method of diagnosing the stage of
`
`endometriosis. Levels of BDNF exhibit a greater increase in comparison to normal controls
`
`at stage 1-11 of endometriosis than at stage III-IV, while levels of glycodelin exhibit a greater
`
`increase in comparison to normal controls at stage III-IV of endometriosis than at stage I-II.
`
`Thus,
`
`levels of BDNF which are greater than 30%, and preferably, 40-50% greater than
`
`14
`
`SUBSTITUTE
`
`

`

`Patent Application
`Atty. Docket No. GWLG-Ol7US-CIP
`
`control levels, are indicative of stage I-II endometriosis, and levels of glycodelin which are
`
`greater than 30%, and preferably, 40-50% greater than control levels, are indicative of stage
`
`III-IV endometriosis.
`
`[0051]
`
`Once a mammal has been diagnosed with endometriosis, the mammal can the